Термотаблетка убл: Термотаблетка убл – Лучшая цена!!! Купить устройство блокировки люка (УБЛ) для стиральной машины Indesit (Индезит)/Ariston (Аристон)

Содержание

Ремонт стиральных машин LG в Симферополе. Часть 3 – замена УБЛ (замка), замена заливного клапана (КЭН), замена нагревателя (ТЭНа), замена помпы. – Стиральные машины – Каталог статей – Мастеркрым +7(978)0731995

1.Замок, устройство блокировки люка или сокращённо УБЛ

         Дефектация, проверка работоспособности и замена этого функционального узла, стоит первой в списке не с проста. Дело собственно вот в чём:

  1. При включении стиральной машины в сеть, общая клема УБЛ подключается к линии питания (L), ровно как и одна из клем реле ТЭНа (HTR_TL). Нейтральный (N) провод сетевого питания при этом, подключен к одному из выводов реле питания, однако сам электронный модуль ещё не запитан, так как линия N не поступает на модуль через разомкнутые контакты реле PWR_REL.
  2. Когда пользователь нажимает кнопку “питания”(SB1), линия N поступает на электронный модуль через R1 и SB1.
  3. Запитанный электронный модуль подаёт питание на силовое реле, которое замыкается, и шунтирует пусковую цепь R1SB1, обеспечивая штатное питание электронного модуля.
  4. После загрузки белья, с соответствующим выбором программы стирки, и последующим закрытием загрузочного люка, нажимается кнопка старт, первым из узлов стиральной машины, начинает свою работу замок – по команде с
    электронного блока управления
    (ЭБУ), через реле DL_RL, линия N подключается к свободному выводу термотаблетки, при этом второй вывод уже подключен к линии L, т.е. термотаблетка подключена к сетевому напряжению. Замок срабатывает, происходит блокировка загрузочного люка, при выполнении которой замыкаются силовые контакты УБЛ, тем самым подавая питание на большую часть схемы стиральной машины (СМ).
  5. Микроконтроллер, определив наличие сигнала о закрытии двери (door lock) начинает выполнение заданной программы стирки.

С работой СМ, в части работы УБЛ, разобрались. Разберём детальней работу самого замка, в чем нам поможет следующая иллюстрация:

       Замки в стиральных машинах LG, чаще всего чаще всего применяются термо-механического типа, т.е. в них установлен позистор

(фактически терморезистор с положительным температурным коэффициентом сопротивления, что означает увеличение сопротивления с ростом температуры), при подаче напряжения на который происходит его нагрев и с повышением температуры нагрев прекращается. Этот самый позистор имеет тепловой контакт с биметаллической пластиной, которая нагревшись выгибается, и замыкает электрическую цепи силовых контактов УБЛ, с одновременным механическим блокированием крючка дверцы СМ, дабы не допустить её открытия во время работы.

     Как видно из схемы, фазная линия подключена к УБЛ постоянно, пока стиральная машина включена в сеть. А вот нейтраль к термотаблетке, подключается через реле замка, расположенное в электронном модуле, управляемое, через транзисторный ключ, с микроконтроллера системы управления.

Рассмотрим основные неисправности замка стиральной машины (УБЛ)
  1.     Отсутствие реакции на подачу управляющего напряжения, стиральная машина не начинает стирку, отображает код ошибки DE. Чаще всего подобная неисправность вызвана разрушением термотаблетки внутри УБЛ из за её разрушения либо обгорания электрических контактов, через которые на неё подаётся напряжение. Реже причиной является обугливание силовых контактов.        В первом случае сопротивление термотаблетки стремится к бесконечности, во втором к той же величине стремится сопротивление силовых контактов.
  2.      УБЛ не снимает блокировку двери по окончании стирки, управляющее напряжение на замок не подаётся, СМ отображает что дверь закрыта. Такое поведение СМ говорит о “залипании” контактов силовой группы. Что не даёт разблокировать крючок двери.
  3.     УБЛ не снимает блокировку двери по окончании стирки, управляющее напряжение на замок не подаётся, СМ отображает что дверь открыта. Такое поведение СМ говорит о том что произошло заклинивание механической части УБЛ. При этом за частую требуется грубое вскрытие замка.
  4.   Стиральная машина не начинает стирку, наблюдается резкий запах гари. Зачастую так проявляется выгорание клем УБЛ. При этом, помимо замены замка, необходимо заменить и клемы.

Как проверить замок (УБЛ) стиральной машины LG.

Оптимальный способ проверки текущей работоспособности замка, без оценки степени его работоспособности, заключается в следующем:

  • подаем, при помощи вилки с клемами типа “мама”, сетевое напряжение на контакты термотаблетки – выводы 1 и 2 замка.
  • сдвигаем механический блокиратор крючка в сторону защёлки, что при исправном замке должно привести к её попаданию в окошко тяги.
  • быстро отключаем питание от замка, и тестером меряем наличие контакта на клемах силовой группы группы УБЛ, контакты 2 и 3 замка. Если они замкнулись, значит УБЛ исправен.

Замена замка (УБЛ) стиральной машины LG

   Для замены УБЛ оптимальным будет использование оригинальных замков для стиральных машин LG, которые всегда имеются в продаже в нашем магазине. Код детали 6601ER1005A, наш внутренний код – 02.10395 Однако при отсутствии такового, можно использовать замки от других стиральных машин, главное чтобы соответствовали установочные размеры. Следует учитывать, что назначение контактов замка при этом может не соответствовать исходному. Поэтому придётся тестером сначала определить к каким выводам подключен терморезистор, затем подать на него питание, после чего отключить и замерить какие выводы замкнулись.

   До тех пор пока не сработала защёлка, неправильное подключение сетевого напряжения не приводит к последствиям, однако после её срабатывания можно устроить короткое замыкание, со всеми вытекающими последствиями. Будьте предельно осторожны при работе с высоким напряжением, и не допускайте таких работ если не имеете соответствующеё квалификации – это реально опасно для жизни!

<-Часть 2 Часть 3 Часть 4->

Как проверить УБЛ стиральной машины тестером

УБЛ стиральной машины – это далеко не самое сложное устройство применяемое в ней, но из-за него ваша «домашняя помощница» может встать мертво. УБЛ – это не что иное, как замок люка стиральной машины, который призван блокировать люк во время реализации циклов стирки, полоскания и отжима белья. Замок работает в автоматическом режиме и если ломается, то блокирует люк или вовсе не хочет его закрывать. В статье мы расскажем, как проверить замок стиралки разными способами, чтобы понять сломалось УБЛ или что-то другое.

Конструкции замков

Прежде чем решить, как проверить УБЛ автоматической стиральной машины нужно хотя бы примерно представлять себе, как устроен такой замок, и какие вообще замки применяются для блокирования люка «домашней помощницы» во время стирки. За последние 30 лет в автоматических стиральных машинах выпускаемых разными производителями для блокировки люка использовались лишь два типа замков: с биметаллическим элементом и электромагнитные.

Электромагнитные замки доказали свою ненадежность и неэффективность, поскольку они могут надежно держать люк лишь когда есть электричество. Поэтому на современные стиральные машины ставят УБЛ на основе биметаллической пластины. Почему такое УБЛ более востребовано и как оно работает?

Все довольно просто. Принцип работы УБЛ стиральной машины с биметаллической пластиной основан на взаимодействии трех основных деталей:

  • термоэлемента;
  • биметаллической пластины;
  • фиксатора.

Когда модуль управления стиральной машины отдает команду УБЛ на блокировку люка, подается напряжение на термоэлемент, который за секунды разогревается, нагревая в свою очередь и биметаллическую пластину. Тонкая и длинная пластина от нагрева расширяется, становясь еще длиннее, при этом она начинает давить на фиксатор, который тут же срабатывает и закрывает замок, надежно блокируя люк. Пока напряжение подается, пластина будет горячей, и дверца люка останется заблокированной.

Если пробьет контакт термоэлемента УБЛ, то этот термоэлемент перестанет нагреваться, пластина останется холодной и фиксатор не сработает – люк останется открытым.

Если УБЛ исправно, то при отключении электричества термоэлемент перестанет нагреваться, пластина остынет, уменьшится в размерах и оттянет фиксатор разблокируя люк. Если УБЛ неисправно или неисправен соответствующий симистор модуля управления, питание будет поступать на замок непрерывно, и он останется закрытым, пока вы не обесточите стиральную машину. Вот так вот это устройство и работает, теперь поговорим о его проверке.

Проверяем тестером

Работу замка более или менее достоверно можно проверить тестером. Лучше всего использовать исправный электронный мультиметр с большим диапазоном. Перед тем как проверить мультиметром устройство блокировки люка автоматической стиральной машины, его придется снять. Мы не будем еще раз рассказывать о том, как снять устройство блокировки люка, если вам нужна данная информация, прочитайте соответствующую публикацию на нашем сайте.

После снятия замка люка нужно посмотреть его схему. Дело в том, что УБЛ с биметаллической пластиной производят довольно многие фирмы и каждая располагает контакты по своему, а нам нужно заранее знать какой контакт за что отвечает, иными словами, где там фаза, где нейтральный, а где общий. Найти такую схему можно в сети Интернет.

Без схемы мы не сможем осуществить качественную проверку замка люка с помощью мультиметра.

Как только мы узнаем о назначении каждого из контактов конкретного замка стиральной машины, нам останется только осуществить проверку.

  • Переключаем тумблер прибора в режим проверки сопротивления.
  • Устанавливаем один щуп на нейтральный контакт замка, а другой на фазовый контакт.
  • Если прибор показывает трехзначную цифру – все нормально.
  • Устанавливаем щупы на два контакта замка: нейтральный и общий.
  • Если прибор показывает ноль или единицу – замок стиральной машины неисправен.

Если электрика замка исправна, но он все равно не работает, совсем не обязательно, что неисправность кроется где-то еще, ведь нужно проверить еще и механику устройства, вдруг заводской брак.

Диагностика по внешним признакам

В ряде случаев можно с невысокой долей достоверности установить, что УБЛ стиральной машинки неисправно даже не разбирая технику. Диагностировать неисправность можно по поведению самой стиральной машины, если вы, конечно, хорошо разбираетесь в ее устройстве и знаете принцип работы всех модулей. Как может вести себя стиральная машина в случаях, когда неисправно УБЛ?

  1. Механика УБЛ однозначно неисправна в том случае, если люк стиральной машины останется заблокированным даже спустя несколько часов после обесточивания «домашней помощницы».
  2. Если вы запускаете программу стирки, а на дисплее машинки появляется код ошибки, свидетельствующий о неисправности УБЛ.
  3. Вы пытаетесь запустить стирку, а УБЛ не желает осуществлять блокировку люка. В этом случае два варианта: либо это замок, либо модуль управления. Точно установить истину поможет замена УБЛ на новое или проверка старого мультиметром, по схеме описанной выше.

Есть еще способы проверки замка, но они требуют доступа к оборудованию, которое в домашних условиях не достать, значит, и обсуждать это не стоит.

Подводя итог, отметим, проверить замок на стиральной машине, который отвечает за блокировку люка, не так просто как может показаться на первый взгляд, однако при наличии минимальных навыков работы с мультиметром и соответствующей схемы УБЛ с задачей справиться вполне можно. Удачи!

   

Как проверить и провести замену замка люка (УБЛ) стиральной машины

Современные автоматические стиральные машины достаточно сложное устройство и в целях безопасности в них предусмотрены определенные системы, которые призваны защитить пользователей от неприятных ситуаций. Например, дверца стиралки на период выполнения цикла запирается специальным устройством — УБЛ (устройство блокировки люка). Он подает сигнал модулю управления о том, что люк закрыт и блокирует его, не давая открыть во время стирки. Если соответствующий сигнал не прошел, стирка не начнется!

Как и любой другой механизм, замок может выйти из строя. Причин неисправностей отметить можно немного, проверить самостоятельно несложно, так что рассмотрим варианты самостоятельной проверки.

 

Принцип работы и виды блокировки

Перед тем, как приступить к проверке устройства, нужно понять, как оно работает. В современных машинах используется два основных типа замка: 

Электромагнитный.  Минус этого замка в том, что он работает, до тех пор пока есть электричество. Если его внезапно отключат, у вас не получится открыть люк.

Биметаллический. Устройство и принцип работы такого замка очень просты и надежны: во время начала цикла стирки на термический элемент подается электричество, отчего он нагревается. Элемент нагревает биметаллические пластины, они выгибаются и оказывают давление на запорный рычаг, который и закрывает дверцу.

     

 

Термозамки с биметаллическими пластинами являются более надежными и производители стиральных машин все чаще используют их в при производстве.

 

Цикл стирки закончен, но люк некоторое время не открывается. Такая задержка предусмотрена для безопасности, чтобы движущиеся части полностью остановились, вода слилась. 

 

Самое важное преимущество термозамков: даже без электричества их можно открыть.

 

Почему УБЛ выходит из строя 

Почему же замок ломается? Вот основные причины неисправности:

  • Продолжительное использование способствует износу биметаллических пластин. Из-за постоянной деформации пластины утрачивают свои функциональные свойства.
  • Нередко замок выходит из строя при причине короткого замыкания.

 

Пока на устройство подается напряжение, оно работает. Поэтому, если ваша стиралка остановилась, но дверь не разблокировалась, не спешите винить устройство блокировки. Скорее всего, сломался симистор на электронной плате, который отвечает за работу УБЛ. Питание подается беспрерывно, поэтому дверца не открывается. 

 

 

 

Самостоятельная проверка замка СМА 

  • машина отключена, однако люк остается закрытым. Причина может быть как в устройстве блокировки, так и в главном модуле.
  • При запуске цикла стирка не начинается, люк остается открытым.
  • Машина выдает код неисправности, означающий неисправность замка. 

Чтобы определить, сломан замок или что-то другое, нужно знать, как проверить устройство тестером. 

Вам нужно демонтировать УБЛ с машины:

  • отключите СМА от сети
  • откройте дверцу
  • отогните манжету люка и снимите ее хомут. 

     

  • вы увидите замок, оттянув манжету сбоку 

  • открутите два болта, которыми крепится замок

     

  • Разожмите все разъемы и достаньте блокиратор. 

  

Теперь, когда УБЛ у вас в руках, вы можете начать проверку замка стиральной машины. Чтобы воспользоваться мультиметром, понадобится схема замка. Это необходимо для определения расположения общего и нейтрального контактов. 

 

В домашних условиях вы сможете проверить только термоэлемент, который нагревает пластины.

  • Установите тестер в режим измерения сопротивления.
  • Приложите его щупы к нейтральному и фазовому контакту 

 

  1. Замок исправен, если на экране показалось трехзначное число.
  2. Щупальца мультиметра переставьте на контакты нейтральный – общий.
  3. Устройство неисправно, если на табло высветилось 1 или 0. 

 

Выяснив, работоспособно устройство блокировки люка в вашей стиральной машине или нет, вам нужно установить замок на место (неважно новый или тот, который сняли). При сборке порядок действий будет обратный:

  • подключите провода к исправному устройству
  • заведите его за стенку корпуса, установите в отверстие для замка
  • закрутите винты крепления
  • установите на место хомут манжеты

Проверка УБЛ в стиральной машине задача не сложная, вы сможете сделать это своими руками. 

Установить новый замок люка при необходимости не составит труда новичку, главное – последовательность действий. 

 

Ремонт, диагностика стиральных машин LG – УБЛ, или по простому “замок” | Александр Демьянов

1.Замок, устройство блокировки люка или сокращённо УБЛ

         Дефектация, проверка работоспособности и замена этого функционального узла, стоит первой в списке не с проста. Дело собственно вот в чём:

  • При включении стиральной машины в сеть, общая клема УБЛ подключается к линии питания (L), ровно как и одна из клем реле ТЭНа (HTR_TL). Нейтральный (N) провод сетевого питания при этом, подключен к одному из выводов реле питания, однако сам электронный модуль ещё не запитан, так как линия N не поступает на модуль через разомкнутые контакты реле PWR_REL.
  • Когда пользователь нажимает кнопку “питания”(SB1), линия N поступает на электронный модуль через R1 и SB1.
  • Запитанный электронный модуль подаёт питание на силовое реле, которое замыкается, и шунтирует пусковую цепь R1SB1, обеспечивая штатное питание электронного модуля.
  • После загрузки белья, с соответствующим выбором программы стирки, и последующим закрытием загрузочного люка, нажимается кнопка старт, первым из узлов стиральной машины, начинает свою работу замок – по команде с электронного блока управления (ЭБУ), через реле DL_RL, линия N подключается к свободному выводу термотаблетки, при этом второй вывод уже подключен к линии L, т.е. термотаблетка подключена к сетевому напряжению. Замок срабатывает, происходит блокировка загрузочного люка, при выполнении которой замыкаются силовые контакты УБЛ, тем самым подавая питание на большую часть схемы стиральной машины (СМ).
  • Микроконтроллер, определив наличие сигнала о закрытии двери (door lock) начинает выполнение заданной программы стирки.

С работой СМ, в части работы УБЛ, разобрались. Разберём детальней работу самого замка, в чем нам поможет следующая иллюстрация:

       Замки в стиральных машинах LG, чаще всего чаще всего применяются термо-механического типа, т.е. в них установлен позистор (фактически терморезистор с положительным температурным коэффициентом сопротивления, что означает увеличение сопротивления с ростом температуры), при подаче напряжения на который происходит его нагрев и с повышением температуры нагрев прекращается. Этот самый позистор имеет тепловой контакт с биметаллической пластиной, которая нагревшись выгибается, и замыкает электрическую цепи силовых контактов УБЛ, с одновременным механическим блокированием крючка дверцы СМ, дабы не допустить её открытия во время работы.

     Как видно из схемы, фазная линия подключена к УБЛ постоянно, пока стиральная машина включена в сеть. А вот нейтраль к термотаблетке, подключается через реле замка, расположенное в электронном модуле, управляемое, через транзисторный ключ, с микроконтроллера системы управления.

Рассмотрим основные неисправности замка стиральной машины (УБЛ)
  •     Отсутствие реакции на подачу управляющего напряжения, стиральная машина не начинает стирку, отображает код ошибки DE. Чаще всего подобная неисправность вызвана разрушением термотаблетки внутри УБЛ из за её разрушения либо обгорания электрических контактов, через которые на неё подаётся напряжение. Реже причиной является обугливание силовых контактов.        В первом случае сопротивление термотаблетки стремится к бесконечности, во втором к той же величине стремится сопротивление силовых контактов.
  •      УБЛ не снимает блокировку двери по окончании стирки, управляющее напряжение на замок не подаётся, СМ отображает что дверь закрыта. Такое поведение СМ говорит о “залипании” контактов силовой группы. Что не даёт разблокировать крючок двери.
  •     УБЛ не снимает блокировку двери по окончании стирки, управляющее напряжение на замок не подаётся, СМ отображает что дверь открыта. Такое поведение СМ говорит о том что произошло заклинивание механической части УБЛ. При этом за частую требуется грубое вскрытие замка.
  •   Стиральная машина не начинает стирку, наблюдается резкий запах гари. Зачастую так проявляется выгорание клем УБЛ. При этом, помимо замены замка, необходимо заменить и клемы.

Как проверить замок (УБЛ) стиральной машины LG.

Оптимальный способ проверки текущей работоспособности замка, без оценки степени его работоспособности, заключается в следующем:

  • подаем, при помощи вилки с клемами типа “мама”, сетевое напряжение на контакты термотаблетки – выводы 1 и 2 замка.
  • сдвигаем механический блокиратор крючка в сторону защёлки, что при исправном замке должно привести к её попаданию в окошко тяги.
  • быстро отключаем питание от замка, и тестером меряем наличие контакта на клемах силовой группы группы УБЛ, контакты 2 и 3 замка. Если они замкнулись, значит УБЛ исправен.

Замена замка (УБЛ) стиральной машины LG

   Для замены УБЛ оптимальным будет использование оригинальных замков для стиральных машин LG, которые всегда имеются в продаже в нашем магазине. Код детали 6601ER1005A, наш внутренний код – 02.10395 Однако при отсутствии такового, можно использовать замки от других стиральных машин, главное чтобы соответствовали установочные размеры. Следует учитывать, что назначение контактов замка при этом может не соответствовать исходному. Поэтому придётся тестером сначала определить к каким выводам подключен терморезистор, затем подать на него питание, после чего отключить и замерить какие выводы замкнулись.

   До тех пор пока не сработала защёлка, неправильное подключение сетевого напряжения не приводит к последствиям, однако после её срабатывания можно устроить короткое замыкание, со всеми вытекающими последствиями. Будьте предельно осторожны при работе с высоким напряжением, и не допускайте таких работ если не имеете соответствующеё квалификации – это реально опасно для жизни!

Устройства блокировки люка, замки люка (убл) | Festima.Ru

Двepцa моpoзильной кaмеры Беко — Kод тoварa: 4692140200 — Kод зaмены: 4554330210 (пpoклaдкa 4546860400, 4546863200) Boзмoжен заказ и пoиcк пo модели вaшeй тeхники Bcегдa в наличии в большом количестве зaпчасти для стиральных мaшин: Bеkо, Blombеrg, Воsch, Siemеns, Neff, Сandy, Zerоwаtt, Elесtrоlux, Ikea, Zаnussi, AЕG, Gоrenje, Hansa, Indesit, Ariston, Ноtроint, Whirlрооl Самсунг, лджи, Ардо, Бош, Сименс, Аристон, Атлант, Аско, Горенье, Ханза, Вестел, Силтал, Занусси, Электролюкс и других марок. – Низкие цены – Гарантия качества – Оплата наличными, картой, на расчетный счет – Доставка по Екатеринбургу, области, России, за рубеж – Отгрузка в день оплаты Челябинск Сони кривой 38 Пункты выдачи по всей России Специальные цены для мастеров и ремонтных мастерских. Большой выбор, запасных частей и аксессуаров для бытовой техники (оптом и в розницу) ( Для стиральных машин, водонагревателей, посудомоек, духовых шкафов, электрических плит, холодильников, утюгов, пылесосов, кондиционеров, СВЧ, мясорубка,шнек, нож, шестерня, шестеренка, микроволновых печей, вытяжек, аэрогрилей, термопотов, хлебопечей, хлебопеч, мультиварок, обогревателей, промышленных мясорубок, фреон и масла, стакрил для ванн, кофемашин, чайников, ручка для холодильника, ручка люка, переключатель духовой шкафа, переключатель плиты, крестовина, промышленная мясорубка, промышленных мясорубок, ). Работаем без выходных и перерыва Более 3000 наименований в наличии Специальные цены для мастеров Доставка по всей России и СНГ почтой России и ТК – Помпа Аskоll, Сорrесi для стиральной машины ( Indеsit, Аristоn, Sаmsung, Воsсh, Siеmеns, Zаnussi, Еlесtrоluх, Саndy, Веkо, Vеstеl, Lg, Индезит, аристон, самсунг, беко, бош, канди, занусси, электролюкс, вестел , Gоrеnjе) . – Тэн для водонагревателя ( Тhеrmех ), thеrmоwаtt термоватт – Приводной ремень 1270, 1213, 1280, 1181, 1195, 1192, 1193, 1252, 1245, щетки двигателя 12.5, 13.5, сальники 30*52, 25*50.55, 35*62 – подшипники, (подшипник для стиральной машины 6202, 6203, 6204, 6205, 6206, 6207, 6303, 6304, 6305, 6306, 6307) кнопки включения, манжеты, убл (устройство блокировки люка) термодатчик, сетевой фильтр, манжета, реданы, бойники, клапан подачи воды, ручка люка, люк в сборе, антисифон, распылитель, анод, патрубок, компрессор, лоток, прессостат, датчик уровня воды, термостат, прокладка, бойлер, шкиф, барабан, бак, петля, петли, термоблокировка, крестовина, крышка бака, суппорт, реле уровня, конденсатор, электроклапан, лопасть, улитка, фильтр, заглушка, фильтр, вентилятор, верхняя петля, ручка двери холодильника, таймер, электрический двигатель, осушитель, фреон, пластина испарителя, предохранитель, лампочка, мотор, стекло, испаритель, керамический стол, жиклер, конфорка, конфорки, переключатели, розжиг, таймер, ручка, ручки, тэн духового шкафа, гриля, нижний, верхний, нож ( нож) мясорубки, противовес, предохранитель шнека, магнетрон, слюда, тэн, гайка, узо, плата, термопара, наконечник, таймер, конденсатор, лента, ремкоплект, пульт, реле, шланг, катушки, смазка, блок розжига, свеча, свечи, конфорка, пэн, уплотнитель, стекло, переключатель режимов духовки, циркуляционный насос, разбрызгиватели, патрубки, корзина, трубка, мешки, держатель мешка, мотор, диод, моторчик, кольцо тарелки, коплер, колпачек магнетрона, кольцо тарелки, тарелка, лопатка, шток, труба медная, флюс, припой, ведро, прокладка клапана, переключатель, конвектор, гайка, нож, шпонка, кольцо упорное, решетка, нож, и многое другое. Воrk, kеnwооd, vitеk, binаtоn, zеlmеr, mоulinех, мулинекс, зелмер, борк, витек, раnаsоniс, sсаrlеtt, rеdmоnd, tеfаl, бриз, аксион, помощница, мим, ита, r134, r410, r600, r12.

Бытовая техника

5 причин ошибки door в стиральной машине Атлант

Опубликовано: 23 Июл 2020

Вы положили вещи в стиральную машину Атлант, закрыли дверцу и запустили программу, но стирка так и не началась, машинка даже не набрала воду, а на табло загорелся код door. Вы дернули дверцу за ручку, и обнаружили, что она не заперта.

Что означает ошибка

Код door на дисплее стиральной машины Атлант сообщает, что машинка не смогла заблокировать дверцу, поэтому стирка не началась. В основном, причина ошибки связана с неисправностью, но прежде чем вызывать мастера, попробуйте устранить ошибку самостоятельно.

Когда исправить ошибку door можно самостоятельно

  • Неплотно закрыли люк. Возможно, вы защемили дверцей бельё или просто неплотно закрыли дверь. Попробуйте открыть и снова закрыть люк до характерного щелчка.
  • «Глюканул» модуль управления. В основном, сбои случаются из-за скачков напряжения в сети. Попробуйте выключить стиралку Атлант из розетки, а затем включить снова.

Не удалось устранить ошибку, следуя советам выше, значит, причина её появления —неисправность.

Характерные поломки

В большинстве случаев ошибка door связана с неисправностью устройства блокировки люка или модуля управления. Вот все поломки, которые мы устраняли при этой ошибке.

Устройство блокировки люка (УБЛ) —
от 1200 руб*

Служит для блокировки дверцы во время стирки. Если УБЛ вышло из строя, дверь не блокируется, поэтому машина даже не начинает набор воды и пишет door на экране. Поломка обычно связана с тем, что горит, плавится или разрушается термотаблетка УБЛ, которая выгибает биметаллическую пластину, и люк блокируется. Изредка сама биметаллическая пластина теряет гибкость, и плохо реагирует на нагрев таблетки.

УБЛ не ремонтируется, его меняют полностью.

Блок управления —
от 1800 руб*

При данной ошибке из строя выходят элементы в цепи УБЛ на плате: сгорают резисторы, пробивает симисторы, выгорают дорожки микросхемы. Из-за того что дверца не блокируется, стиральная машина не приступает к стирке.

Мастер диагностирует плату, выявляет, что сгорело, меняет неисправные элементы на новые и пропаивает дорожки. В случаях сильного выгорания платы она полностью меняется на новую.

Из практики мастеров! Часто причиной поломки модуля является неисправное УБЛ. Поэтому перед ремонтом платы необходимо тщательно проверить устройство блокировки и при необходимости заменить его.

Проводка или соединения в цепи УБЛ —
от 1400 руб*

Необходимо проверить все разъёмы и провода от замка до блока управления. Возможно, где-то случился обрыв, поэтому УБЛ не отвечает на команды модуля управления и стиральная машина Атлант выдаёт ошибку door. Бывает, что проводка перетирается от постоянных вибраций, контакты окисляются или прогорают.

Мастер выявляет, где случился обрыв сигнала и:

  • делает скрутку проводов или целиком меняет шлейф;
  • обрабатывает и пропаивает контакты или полностью меняет контактную группу.

*Цены указаны без учёта деталей. Если для ремонта понадобятся запчасти, они оплачиваются дополнительно.

Вы не смогли устранить ошибку door на стиральной машине Атлант? Вызовите мастера из «Вош Мэн». Приедем сегодня, завтра или когда скажете. Выясним причину ошибки, при необходимости и с вашего согласия проведём ремонт на дому. После ремонта проверим работу машинки и выдадим гарантийный талон сроком до 2 лет. Звоните!

Желаем здоровья вашей технике!

Код ошибки DE стиральных машин LG: что означает, как исправить


Расшифровка ошибки

Ошибка DE обозначает, дверь стиральной машины не закрыта или же не работает блокировка люка. В основном причина неисправности заключается в устройстве блокировки люка (УБЛ), но также могут быть неисправны петли, ручка, крючок фиксатора или же модуль управления.

На стиральных машинах LG без дисплея код DE обозначается: одновременно мигают или горят все индикаторы температуры, режим стирки и полоскание. Такие сигналы указывают на то, что дверца люка не закрыта.
Смотрите также –
Ошибка PF в стиральной машине LG – что делать, как расшифровать?

Характерные поломки

Внушительный опыт ремонта стиральных машин Лджи помог нам собрать список возможных неисправностей, при которых загорается код dE на дисплее. Условно их можно подразделить на электронно-электрические и механические.

Устройство блокировки люка (УБЛ) — от 1600 руб*

УБЛ предназначено для блокировки дверцы машины LG во время стирки. Если оно выходит из строя, люк не блокируется, и стирка не начинается.

В устройстве выгорает и разрушается термотаблетка, которая при прохождении через неё электрического тока нагревается и выгибает биметаллическую пластину. Пластина толкает фиксатор, который цепляет язычок и блокирует люк. Реже деформируется или теряет гибкость сама биметаллическая пластина.

Неисправность УБЛ — самая распространённая причина ошибки dE в стиральных машинах LG. Чтобы исправить ошибку, нужно заменить устройство на новое, ремонту УБЛ не подлежит.

Электронный контроллер (плата управления) — от 2300 руб*

Из строя выходят элементы платы, которые отвечают за управление УБЛ, в частности: резисторы, симистор, дорожки микросхемы в цепи УБЛ. Они горят из-за скачков напряжения или попадания влаги на плату. По этой причине УБЛ не срабатывает, дверца не блокируется, машинка LG не набирает воду и не стирает.

Мастер проверяет контроллер мультиметром, выявляет сгнившие или сгоревшие элементы и дорожки. Неисправные радиоэлементы меняются на новые, дорожки — заново пропаиваются. Если выгорела внушительная часть контроллера или вышел из строя процессор модуля управления, плата меняется на новую.

Петля люка — от 1400 руб*

Из-за механического повреждения петли или места её крепления на корпусе машинки дверца провисла, и язычок на люке не попадает в отверстие УБЛ. Поэтому дверь не закрывается, и стиральная машина LG выдаёт ошибку dE.

Из практики мастера! Причиной повреждения петель часто являются «маленькие любители» покататься на дверце. Не допускайте маленьких детей к технике. Помимо возможных поломок, которые может причинить технике ребёнок, она может быть опасна для здоровья и жизни малыша.

Попробуйте отрегулировать или подтянуть болты, которые крепят петлю к корпусу стиральной машины. Если это не помогло, то петлю (или петли, если их две) придётся менять.

Механическое повреждение замка — от 1600 руб*

При небрежной эксплуатации, бывает, что механически ломается ручка двери, язычок, выпадает шток крючка. Из-за этого язычок не попадает в паз замка, и люк не закрывается.

Мастер меняет сломавшиеся детали. В редких случаях требуется замена дверцы.

Проводка в цепи УБЛ — от 1800 руб*

Иногда дверца штатно закрывается, УБЛ и контроллер исправны, но стиральная машина LG, по-прежнему, не блокирует люк. Значит, причина — в проводке или контактах в цепи УБЛ. Проводные шлейфы перетираются от вибраций при работе стиральной машины, контакты окисляются или подгорают.

Мастер проверяет проводку, находит обрыв и делает скрутку проводов либо меняет весь шлейф. Контакты зачищаются и пропаиваются.

*Цена без запчастей, необходимые детали оплачиваются отдельно

Не можете сами справиться с ошибкой dE? Обращайтесь в «Вош Мэн». Мы отремонтировали тысячи стиральных машин LG, вернём в строй и вашу технику. Приезжаем на дом в течение суток, делаем ремонт на дому, после этого даём гарантию до 2 лет. Звоните! Мы обязательно поможем.

Как устранить ошибку самостоятельно

Казалось бы причина неисправности известна и достаточно лишь плотнее закрыть люк. Зачастую, таких действий бывает достаточно и проблема исчезает. В противном случае неисправность возникает по более серьезной причине:

  • Поломка крючка фиксатора, устройства блокировки люка
  • Смещение пружины или хомута, устройства блокировки люка
  • Неисправность электронного датчика устройства блокировки люка
  • Неисправность платы управления стиральной машины

Важное:

Здесь перечислены самые распространенные причины ошибки, возможны и другие менее известные поломки и для их точного определения, рекомендуется вызвать специалиста.

В случаях возникновения кода DE, рекомендуют провести ряд последовательных действий, которые могут помочь избавиться от ошибки самостоятельно.

  • Для начала стоит проверить плотность закрытия люка, возможно, он не закрыт. Для этого следует лишь посильнее прижать его.
  • Также следует осмотреть всю дверцу на наличие внешних помех.
  • Осмотрите дверцу люка изнутри, возможно попала одежда между загрузочным люком и барабаном и мешает плотному закрытию. Также следует обратить внимание на язычок фиксатора, возможно на нем есть предметы, мешающие закрытию.
  • Проверьте дверцу люка на наличие перекосов, в случае их обнаружения, необходимо подтянуть боковые петли.
  • Если ничего из выше перечисленного не обнаружено или не помогло, следует осуществить полную перезагрузку стиральной машины. Для этого последовательно совершите следующие действия: откройте люк, отключите машинку от сети, выдернув вилку из розетки, подождите 15-20 минут, затем снова подключите машину и закройте люк.

Если после выполнения перечисленных действий ошибка сохранилась, значит есть смысл рассмотреть другие причины неисправности.

Что делать, при наличии данной неисправности

Ошибки, которые фиксируются стиральной машиной можно условно разделить на три основных типа:

  1. В редких случаях может произойти так, что ошибка просто со временем перестанет появляться. При этом окажется, что она прошла сама собой.
  2. В этой ситуации пользователь предпринимает определённые усилия, после которых машина становится работоспособной.
  3. Эта категория относится к наиболее сложным случаям. Приходится приглашать специалиста. Он решит, как исправить поломку, произведёт ремонт и починит машину, но стоимость ремонта будет достаточно высокой.

Поэтому разумным порядком действий будет такой, когда сначала пользователь сделает всё, что сможет, а если не получится, обратится к мастеру.

Если дисплей показывает DE, нужно проконтролировать возможное наличие мелких предметов, препятствующих закрыванию. Это могут быть оторвавшиеся детали одежды или пуговицы. Также возможно, что в карманах одежды, предназначенной для стирки, оставались небольшие предметы, например, монеты.

Практически при любых кодах ошибок есть небольшая вероятность того, что речь идёт о сбое системы.

Чтобы проверить такую версию, когда выдает DE, необходимо стиральную машину отключить от сети и подождать некоторое время. Перед отключением нужно плотнее закрыть люк. Обычно ждут от 10 до 20 минут.

После этого машину снова включают в сеть. Люк надо плотно закрыть.

Если сообщение системы диагностики о поломке больше не появляется, можно считать, что это был случайный сбой.

Эту процедуру желательно повторить несколько раз с перерывом в 10 — 15 минут.

Если попытка не дала результатов, необходимо выполнить процедуру диагностики для ситуации, когда выдается код ошибки DE, разработанную специалистами фирмы LG:

  1. Нужно посмотреть, насколько сильно износились детали. Для этого нужно осмотреть как механизм закрытия люка, так и петли, к которым он прикреплён.
  2. В некоторых случаях износ петель приводит к перекосу люка. Для исправления ситуации достаточно будет их подтянуть.
  3. Одной из распространённых причин ошибки, когда горит DE, является поломка ручки, с помощью которой происходит закрывание люка.
  4. Начинается проверка с осмотра крышки люка и определения исправности блокировочного крючка. Для того, чтобы убедиться в его работоспособности, его нужно намного пошевелить пальцем. Крючок обычно изготавливают из пластика или сплава под названием силумин. Если он сломан, отремонтировать его не получится. Для его замены придётся покупать механизм блокировки полностью.
  5. Если неисправность не обнаружена, нужно проверить ответную часть механизма блокировки. Её нужно отсоединить от машины. Для того, чтобы это сделать, нужно открутить два самореза, на которых держится эта часть.
  6. Теперь вытаскиваем устройство блокировки, следя при этом, чтобы датчик по-прежнему был подключён к управляющему контроллеру. Теперь включаем стиральную машину. На узкой части данного устройство можно легко увидеть контакт. Его необходимо замкнуть.
  7. Смотрим, не выдаёт ли система диагностики данную ошибку. Если этого нет, проверяем, есть ли возможность в этой ситуации выставить режим стирки. В случае, если это возможно, следует вывод о том, что устройство блокировки люка неисправно и его необходимо отремонтировать или заменить.

Если же данная процедура показала, что блокировка работает исправно, нужно продолжить процедуру диагностики. Это заставляет предположить, что причина сбоя находится в неисправной электронике. Чтобы это проверить, делаем следующее:

  1. Сначала требуется снять пластиковую крышку. Для этого нужно поддеть отвёрткой пластиковые фиксаторы, которые её удерживают.
  2. Теперь нужно отсоединить электронный блок. Для этого нужно выкрутить шурупы, которые его удерживают.
  3. В состав блока входят две части. Одна из них, имеющая больший размер, включает в себя информационный дисплей. Другая, меньшего размера, управляет запуском и отключением машины. Нам нужна вторая плата.
  4. Большую плату просто отсоединяем и убираем в сторону.
  5. Теперь предстоит тщательно осмотреть оставшуюся плату. При этом нужно искать возможные механические или другие повреждения на ней.
  6. Если плата выглядит исправной и повреждения отсутствуют, значит теперь осталось обратиться к специалистам.

Одним из характерных признаков повреждения управляющей платы является запах гари.

Также возможно повреждение проводов, присоединяющих датчик к управляющей плате.

Неисправности, требующие ремонта

Для определения причины ошибки воспользуйтесь следующей таблицей:

Описание проблемыПричина ошибкиРешение проблемы
Дверца люка полностью не закрывается и не фиксируется.Крючок фиксатора сильно изношен или сломанЗамена элемента
Дверь закрывается и фиксируется, но машинка не запускает программу стирки.Устройство блокировки замка вышло из строяЗамена элемента
В режиме стирки, полоскания или отжима, стиральная машина прекратила работу и выдала ошибку DE. Ощущается запах гари.Неисправен модуль управления. Чаще всего микросхема «страдает» из-за перегорания контактов при скачках напряжения или из-за попадания воды в электронику.Нужно снять переднюю панель, демонтировав верхнюю часть машинки. После этого вынуть плату. Поврежденные места сразу видны – они чернеют, шляпки конденсаторов становятся выпуклыми, видны следы разрывов. При обнаружении неисправной детали она выпаивается, а на ее месте устанавливается новая.
Не работает ручка и дверца не фиксируется.Поломка ручкиЗамена элемента
Дверь люка не закрывается и наблюдается перекосИзнос петельРегулировка петель или полная их замена

Ремонт платы управления LG.

У стиральных машин LG плата управления состоит из двух частей. На одной установлены кнопки и драйвер кнопок, а вторая, она же основная, является силовой частью. На силовой половине установлены различные реле и управляющие микросхемы. Эта часть модуля залита силиконовым герметиком, поэтому чтобы добраться до нужного элемента, есть два варианта: или постепенно выскребать герметик и извлекать силовую часть модуля из пластикового короба, или снять из пластикового короба управляющую часть и из под нее с помощью паяльника сделать окошко в нужном месте. Второй вариант намного проще, но возникает вопрос: а где искать неисправность и в каком месте проплавить окошко?

Дефект этот довольно стандартный и из собственного опыта скажу, что проблема скорее всего в реле питания, оно либо полностью вышло из строя, что происходит редко, либо отгорели его ножки. На фото ниже видно реле черного цвета.

Итак, с помощью плоской отвертки снимаем управляющую половину модуля.

Теперь с помощью паяльника выплавляем окошко под нужными нам элементами, затем отверткой аккуратно убираем герметик.

На фото видим неисправность: ножка реле отгорела.

Берем паяльник и пропаиваем отгоревшие ножки, также пропаиваем соседние реле.

Паяльником припаиваем обратно кусок пластика.

Собираем аппарат в обратной последовательности, устанавливаем все узлы на место и проверяем его работоспособность на режиме стирки.

Данная неисправность не является сложной, и ее вполне может устранить человек, умеющий немного обращаться с отверткой и паяльником. Но если Вы всё-таки не уверены в своих силах, тогда лучше обратитесь к профессионалам.

Что делать, если появилась ошибка DE на стиральной машине Самсунг?

Если стиральная машина Самсунг показывает ошибку DE, перед тем как вызывать мастера стоит самостоятельно проверить возможные неисправности. Часто неисправность возникает из-за превышения допустимого объема белья при стирке, или слишком горячей воды. В последнем случае металл сильно нагревается и расширяется, таким образом возникает незначительная деформация стенок машины. Для самостоятельного устранения неполадки следует:

  • проверить полностью ли закрыта дверца люка;
  • если сигнал про неисправность не пропадает, то открыть дверцу и проверить не попадает ли белье на замок;
  • проверить не мешает ли срабатыванию замка посторонние предметы, нитки, волосы;
  • удостоверится в отсутствии механических повреждений и деформации деталей;
  • после проверки поставить машинку на отжим и слив воды;
  • если белья слишком много и оно мешает полностью закрыть крышку, то следует вытащить часть;
  • если белья слишком мало и неполадка возникла на процессе отжима, то следует выключить машинку. Доложить до необходимого веса еще белья и включить машинку, а также повторить цикл.

Онлайн-диагностика стиральной машины

Если Ваша машинка перестала нормально стирать или полоскать белье, то произошел какой-то сбой или случилась поломка. Вы можете самостоятельно попробовать найти проблему.
Запустить диагностику

Выберите какую операцию не выполняет Ваша стиральная машина:

1. Не сливает 2. Не вращает барабан 3. Не отжимает белье 4. Шумит, стучит, гудит при отжиме 5. Не включается

Проверка работы сливного насоса Работает ли сливной насос стиральной машины? Да Нет Не знаю << Назад

Засор в шлангах стиральной машины Если звук соответствует нормальному, который всегда наблюдался при работоспособном устройстве, вероятно, причина в засоре.

Был ли засор в сливном шланге? Да

<< Назад

Не рабоатет сливной насос! Если звук соответствует нормальному звуку сливного насоса, рекомендуется для начала проверить фильтр, предназначенный для слива.

После чистки сливной насос работает, стиральная машина сливает воду? Да Нет

<< Назад

Работа сливного насоса Звук насоса обычно слышен сразу, и он заметен. Если звука нет — насос не работает. Отыскиваем, как отдельно включить программу слива воды. Как правило — это отдельная опция. После того, как программа была включена, через 1-3 секунды должен заработать насос. Если все сделано правильно, а насос работоспособный — появится звук жужжания. Если при включении программы вы не услышали ни жужжания, ни других звуков, вероятно, насос неисправен.

Работает ли сливной насос стиральной машины? Да Нет

<< Назад

Засор в шлангах машины Если вами был установлен засор в шлангах, их нужно разобрать, прочистить, а потом все собрать.

Вода из стиральной машины сливается хорошо? Да Нет

<< Назад

Ура, вы молодец, починили.

<< Вернуться к началу диагностики

Неисправен сливной насос, вызывайте мастера.

<< Вернуться к началу диагностики.

Стиральная машина не вращает барабан В процессе работы стиральной машины может возникнуть такая проблема. У каждой модели, работа барабана отличается. Он вращается по заданному алгоритму, который устанавливается программой. Этот принцип касается отжима и стирки. Если вы не уверены, что именно барабан не вращается или что он работает, положите белье в стиральную машину. Включите программу отжима. Если машина работает, она в первую очередь сольет воду, а затем начнет отжимать. При этом будет наблюдаться вращательный процесс. Если вращения не видно, то проверяйте ремень. Сначала выключаем программу, потом отключаем с розетки провод, чтобы питание не поступало в устройство. Теперь нужно снять заднюю крышку. От вас потребуется внимательный осмотр ремня барабана. Определить неправильное его положение либо повреждение довольно просто.

Ремень стиральной машины порван или растянут? Да Нет

<< Назад

Обрыв ремня привода барабана Если ремень порвался, это сразу будет видно. Также часто встречаются случаи, когда ремень попросту растягивается, из-за чего и барабан, соответственно, не вращается. Нельзя допустить работы машины при обрыве ремня. Важно проверить, не намотался ли он на шкив двигателя, не порвал ли при этом проводку к двигателю. Также могут пострадать ТЭН и датчик температуры, если провода ремень все-таки зацепил. В обязательном порядке важно проследить, чтобы модель ремня была оригинальной. В случае выбора неподходящего либо некачественного изделия, это отразится на работоспособности других устройств. Как узнать, какой у вас ремень? На старом будет написана маркировка, сравните ее с той, которая указана на предложенном вам ремне. Также можно выяснить данные о ремне по модели машины.

<< Вернуться к началу диагностики.

Неисправность двигателя стиральной машины Если неисправность не была найдена, колодку с проводами нужно отсоединить от электродвигателя. Аккуратно снимаем его. Оцениваем визуально двигатель. На нем могут быть оплавления, трещины, другие эффекты, явно намекающие на повреждение. Прозваниваем обмотки тахогенератора и двигателя. Важно понимать, что полностью изучить то, насколько правильно работает двигатель и есть ли неисправность, можно исключительно на стенде. Если вращение не происходит, не только в двигателе может быть неисправность. Иногда причина — неработающий электронный модуль. Если в двигателе случилось замыкание, модуль мог пострадать, при этом двигатель остаться работоспособным. А также, могли повредится провода.

<< Вернуться к началу диагностики.

Ремонт стиральной машины, не отжимает бельё После завершения процесса стирки стиральная машина может недостаточно качественно отжимать или не запускать отжим. Во-первых, посмотрите, возможно, установлен другой режим, который не предполагает включение отжима вовсе. Так бывает, например, с программами связаными со стиркой шерстяных вещей и тонких тканей. Для проверки отдельно запускаем отжим. Если стиральная машина не совершает слив воды, переходим на проверку насоса.

Теперь стиральная машина отжимает белье? Да Нет

<< Назад

Поздравляем, вы решили свою проблему!

<< Вернуться к началу диагностики.

Ремонт стиральных машин, дисбаланс Современные стиральные машины перед отжимом раскладывают белье по барабану. Это необходимо для качественной работы. Проверьте, работает ли эта функция. Иногда случается ситуация, когда вещи сматываются в клубок, который за определенное время не удается разматывать в автоматическом режиме. На этом этап работы останавливается. Нужно размотать это белье самостоятельно, разложить его и продолжить работу стиральной машины. При этом важно отключить машину, а потом, когда разложено белье, включить отдельную программу для отжима.

Теперь стиральная машина отжимает белье? Да Нет

<< Назад

Ремонт стиральных машин, реомнт привода барабана Теперь нужно проверить ремень привода барабана. Снимаем крышку, визуально оцениваем состояние ремня. Повреждений быть не должно. Если натяжение слабое, отжим может не включаться. Если нужна замена ремня, менять следует только на оригинальный. После замены пробуем снова программу.

Неисправность найдена, стиральная машина отжимает? Да Нет

<< Назад

Неисправен двигатель, электронный модуль, вызывайте мастера на дом.

<< Вернуться к началу диагностики.

Стиральная машина гудит, шумит при отжиме, грохочет, издает гул реактивного самолета. Если во время работы стиральная машина шумит, издавая непривычные звуки, пора обратить на это особое внимание. При этом видимая поломка или отсутствие функциональности могут не наблюдаться, но появление странных звуков свидетельствует о том, что пора искать неисправность. Важно понимать, что новая машина, которую только что привезли, должна быть осмотрена на предмет наличия транспортировочных болтов. Если их забыли снять, шум и вибрация неизбежны. Итак, начнем! Проворачиваем барабан стиральной машины и слушаем посторонние звуки.

При вращении слышится посторонний шум, гул, перекатывание шариков, барабан движется неравномерно с небольшими заеданиями? Да Нет

<< Назад

Если барабан вращается и при этом появляются нехарактерные звуки, в том числе вибрация, пора проверить подшипники. При неисправности их придется заменить.

<< Вернуться к началу диагностики.

Открутился противовес стиральной машины Крепление противовесов тоже должно быть качественным. Если они «разболтались», пора устранить этот дефект. В ряде случаев можно заметить, что болты, которые крепят камни, и вовсе отсутствуют. При этом будут видны разъемы для крепления. Болты нужно найти и поставить на место — вероятно, они попросту раскрутились. О том, что болты частично раскрутились, может говорить грохот, слышный в процессе работы стиральной машины. Чтобы проверить болты, можно попросту толкнуть барабан. Если он закреплен, болты в порядке. Если подвинулся, дефект есть.

Слышится ли шум, лягз или дребезг при перемещении бака стиральной машины? Да Нет

<< Назад

Отошел противовес

<< Вернуться к началу диагностики

Проверка амортизаторов стиральной машины Проверка амортизаторов. Если слышится вибрация или чрезмерный шум во время отжима, возможно, проблема с амортизаторами. Иногда стиралка перемещается. Теперь проверяем работоспособность. Снимаем верхнюю крышку. Жмем на бак, перемещаем его на пять-семь сантиметров вниз. Нормальная реакция будет наблюдаться, если бак резко поднимется вверх, немного подпрыгнув и остановившись на своем нормальном месте. Если этого не произошло, нужно заменить амортизаторы.

Амортизаторы стиральной машины исправны? Да Нет

<< Назад

Если видимый дефект не был установлен, проверьте, возможно в машину попал инородный предмет. Замена амортизаторов. Проблема с износом амортизаторов, бывают достаточно часто с течением времени.

<< Вернуться к началу диагностики.

Замена амортизаторов стиральной машины. Неисправность, износ амортизаторов явление довольно распространенное.

<< Вернуться к началу диагностики.

Не включается стиральная машина Стоит попробовать самостоятельно найти причину неисправности и ее устранить. Начинаем с подключения устройства к сети. Далее жмем на кнопку «сеть». В разных моделях машин срабатывает разная индикация: тут либо дисплей начнет работать, либо, напротив, какая-то другая кнопка.

Есть ли индикация у стиральной машины? Да Нет

<< Назад

Блокировка замка люка (УБЛ) Проверить можно с помощью включения любой из программ. Выбираем, что будем использовать. Жмем на соответствующую кнопку. Не забудьте обратить внимание на включение. Как правило, процесс активации какой-либо функции характеризуется наличием определенного звука, например щелчка, с помощью которого устройство дает понять, что повторное нажатие не нужно и машина уже работает. Если звук не появился, возможно, сломана кнопка. При этом основное, что должно быть сделано, — это блокировка люка и начало работы. Если это происходит, все в порядке.

Стиральная машина блокирует люк, срабатывает УБЛ? Да Нет

<< Назад

Неисправность клапана налива воды

<< Вернуться к началу диагностики.

Не блокируется люк стиральной машины

<< Вернуться к началу диагностики.

Отсутствует индикация Проверка электроцепи. Если вы заметили, что стиральная машина не реагирует на включение, в первую очередь рекомендуется проверить подачу энергии. Возможно, розетка неисправна. Попробуйте подключить другое устройство. Если розетка работает, нужно проверить, целостна ли цепь, которая проводит по стиральной машине энергию от одного элемента к другому. Для этого понадобится мультиметр, который поможет полностью проанализировать на нескольких этапах работы способность отвечать на электрический сигнал. Если где-то будет отсутствовать связь по сети, вероятно, в этом вся проблема. Проводим данную манипуляцию, пока не дойдем до электронного модуля. Если речь идет о старой стиральной машине, здесь он будет выглядеть, как программа аппарата. Когда вы включите кнопку, разрывы в цепи не должны наблюдаться. Если цепь работает, с электричеством все в порядке.

Цепь питания стиральной машины исправна? Да Нет

<< Назад

Ремонт электронного модуля (блока)

<< Вернуться к началу диагностики

Неисправность контактной цепи

<< Вернуться к началу диагностики

Отметим, что код ED выводится на старых моделях, которые в настоящее время не производятся. Рассмотрим причины, по которым появляется поломка:

  1. Не до конца закрыт люк.
  2. Ошибка соединения контактов из-за сломанного крючка или всего механизма.
  3. Неисправен замок.
  4. Повреждены контакты УБЛ или провода.
  5. Неправильное подключение.
  6. Поломка модуля управления.
  7. Ошибка возникает, если замок был закрыт/открыт более чем 20 раз за 2 мин.
  8. Причиной также могут быть сильные удары по дверце во время работы и мощное прижатие двери из-за разницы давления в программе «Кипячение».

Стиральная машина «Самсунг Диамонд»

Сигнал о закрытии не доходит до электронного модуля, и в результате возникает этот код, и работа машинки блокируется. Рассмотрим по каждому пункту, что надобно предпринять для исправления положения:

  1. Нужно просто плотно закрыть люк до характерного щелчка, и заново запустить программу.
  2. Случаются поломки обратной части замка — крючка или внутренних креплений. Это происходит из-за преждевременного дёрганья ручки открывания люка, которое приводит к поломке одной из частей механизма. Нужно снять дверцу и разобрать её. Затем на место повреждённой обратной части замка установить новую. В зависимости от моделей СМА Samsung, применяются разные устройства. Подбирать нужно по «вин» номеру.
  3. Замок блокирует дверцу во время всей программы стирки, и через него постоянно проходит ток. Это приводит к износу и со временем УБЛ ломается. В этом случае нужна его замена. Все работы выполняются на отключенной от сети СМА. Снимается хомут на манжете. Затем сдёргивается часть рядом с замком. Откручивается два самореза и УБЛ вытягивается из корпуса. После отсоединения фишки, меняется на новый.
    Вы стираете обувь в машине?

    О-да!Нет

  4. Иногда бывают повреждения контактов, или они окисляются. Для восстановления, достаём замок как описано в пункте выше и зачищаем или меняем соединения. Проверяем целостность проводов с помощью мультиметра. При необходимости ставим новые.
  5. Иногда при замене путают расположение фишки. Такое же положение возникает при установке отдельных контактов. Поэтому на электронный контроллер не приходит сигнал, информирующий о закрытии люка. Совет! Перед началом работ — фотографируйте!
  6. Модуль может повредится, при скачке напряжения, например, при поломке УБЛ. В этом случае необходимо приобретение нового или ремонт повреждённого. Без мастера службы по ремонту бытовой техники здесь не обойтись.
  7. Ошибка пройдёт, если выключить стиральную машину из сети на несколько минут.
  8. Аналогично пункту 7.

Мнение эксперта

Работаю в сфере ремонта бытовой техники. Большой опыт в восстановлении стиральных и посудомоечных машин.

Задать вопрос

Как видно, что большинство вероятных причин можно исправить самостоятельно.

Признаки поломки

Сейчас код «Ed» редко когда можно увидеть на экране стиральной машины. Обозначение поломки таким образом проводилось в технике, которую собирали и выпускали до 2008 года. Позже данный код ошибки в линейке стиральных машин Samsung был изменен .

Сам код дополняется цифровыми обозначениями:

В моделях стиральных машин Самсунг данные коды могут появляться вместе с буквой «С» вместо «Е». Иногда на дисплее выбирается не код, а словесное обозначение — door error либо сокращенное door.

Если машинка не имеет дисплея – о проблеме сообщают мигающие лампочки, подвеска сразу всех индикаторов температуры воды. Все говорит о том, что неисправность есть и ее нужно срочно устранить.

Рекомендации

Дополнительные советы от специалистов, которые помогут решить проблемы:


  1. Не следует пытаться устранить серьезную неполадку с дверью, не имея умений и навыков в таких работах. Только специалист может осуществить грамотную диагностику и качественно провести ремонтно-наладочные работы.

  2. Профилактическая чистка стиральной машины от накипи – вещь полезная.
  3. Внутреннюю часть барабана и уплотнительные резинки люка необходимо держать в чистоте.

Несмотря на надежность бытовой техники компании Самсунг, небрежное отношение к аппарату и не соблюдение правил пользования, повышает риск возникновения поломок.

Узнать больше о кодах ошибок стиральных машин Самсунг можно здесь.

Что означает ошибка DE

Код «DE», который выдает машина обозначает неполадки с блокировкой люка. Код может иметь другие виды, к примеру — «Door», «Ed», «dE1» и «dE2». Все они расшифровываются как «Door Eror», что в переводе с английского языка будет означать «Ошибка дверцы».

Такое сообщение свидетельствует о неисправности в агрегате. Но иногда проблему удается устранить собственными силами, не прибегая к помощи мастеров.

Кристаллическая структура убиквитиноподобного домена фактора сборки рибосомы Ytm1 и характеристика его взаимодействия с AAA-ATPase Midasin

J Biol Chem. 8 января 2016; 291 (2): 882–893.

Эрин М. Ромес

Из лаборатории преобразования сигналов, NIEHS, Национальные институты здравоохранения, Министерство здравоохранения и социальных служб, Парк Исследовательского треугольника, Северная Каролина 27709

Мак Собхани

Из лаборатории преобразования сигналов, NIEHS, Национальный Институты здравоохранения, Департамент здравоохранения и социальных служб, Парк Исследовательского треугольника, Северная Каролина 27709

Робин Э.Стэнли

Из лаборатории преобразования сигналов, NIEHS, Национальные институты здравоохранения, Департамент здравоохранения и социальных служб, Парк Исследовательского треугольника, Северная Каролина 27709

Из лаборатории преобразования сигналов, NIEHS, Национальные институты здравоохранения, Департамент здравоохранения и человека Services, Research Triangle Park, North Carolina 27709

1 Кому следует направлять корреспонденцию: Signal Transduction Laboratory, NIEHS, National Institutes of Health, Bldg.101, Ком. F378, 111 T. W. Alexander Dr., Research Triangle Park, NC 27709., тел .: 919-541-0270; Электронная почта: [email protected]

Поступило 18 сентября 2015 г .; Пересмотрено, 16 ноября 2015 г.

Авторские права © 2016 Американское общество биохимии и молекулярной биологии, Inc. Эта статья цитируется в других статьях в PMC.

Abstract

Синтез эукариотических рибосом – сложный, энергоемкий процесс, требующий помощи множества нерибосомных факторов, таких как комплекс PeBoW.Комплекс PeBoW млекопитающих, состоящий из Pes1, Bop1 и WDR12, необходим для процессинга прерибосомной РНК 32S. Предыдущая работа в Saccharomyces cerevisiae показала, что высвобождение гомологичных белков в этом комплексе (Nop7, Erb1 и Ytm1 соответственно) из прерибосомных частиц требует Rea1 (мидазин или MDN1 у людей), большого динеин-подобного белка. Мидазин содержит домен C-концевого участка адгезии, зависимого от ионов металлов (MIDAS), который взаимодействует с N-концевым убиквитин-подобным (UBL) доменом Ytm1 / WDR12, а также доменом UBL Rsa4 / Nle1 на более позднем этапе путь созревания рибосом.Здесь мы представляем кристаллическую структуру домена UBL гомолога WDR12 из S. cerevisiae с разрешением 1,7 Å и демонстрируем, что мидазин человека связывается с WDR12, а также с Nle1 через их соответствующие домены UBL. Мидазин содержит хорошо консервативную область удлинения выше домена MIDAS, необходимую для связывания WDR12 и Nle1, и взаимодействие зависит от координации иона металла, поскольку удаление металла или мутация остатков, которые координируют ион металла, ослабляют взаимодействие.WDR12 млекопитающих обнаруживает выраженную локализацию ядрышка, которая зависит от активной транскрипции рибосомной РНК. Основываясь на этих результатах, мы предполагаем, что высвобождение комплекса PeBoW и последующее высвобождение Nle1 с помощью мидазина является хорошо законсервированной стадией в пути созревания рибосом как в клетках дрожжей, так и в клетках млекопитающих.

Ключевые слова: АТФазы, связанные с различными клеточными активностями (AAA), кристаллография, взаимодействие ионов металлов с белками, процессинг рибосомных РНК (процессинг рРНК), сборка рибосом

Введение

Рибосомы – это большие макромолекулярные машины, состоящие из четырех частей рибосом. РНК (рРНК) , 2, и 80 (79 у дрожжей) ассоциированных рибосомных белков (1, 2).Рибосомы отвечают за синтез всех белков в клетке, а эукариотическая рибосома состоит из двух субъединиц, известных как малая субъединица (40S) и большая субъединица (60S). Сборка рибосом начинается в ядрышке с транскрипции рРНК. Три из рРНК транскрибируются как один полицистронный предшественник (18S, 5.8S и 25S), который затем должен быть модифицирован, свернут, обработан и экспортирован в цитоплазму тщательно организованным образом (3, 4).Биогенез рибосом в эукариотических клетках – невероятно сложный и энергозатратный процесс, который требует более 200 основных факторов сборки не рибосом (3, –6).

Дефекты пути биогенеза рибосом у млекопитающих связаны с группой заболеваний человека, которые вместе называются рибосомопатиями. Все это врожденные наследственные заболевания с широким клиническим спектром, которые в течение многих лет ставили исследователей в тупик, поскольку они вызывают тканеспецифические эффекты, хотя рибосомы необходимы для всех типов клеток (7).Биогенез рибосом также становится новой мишенью для лечения рака. Недавние исследования показали, что несколько важных онкогенов, включая cMYC , RAS и PI3K , играют ключевую роль в стимулировании гиперактивного биогенеза рибосом, а дерегулированная транскрипция рибосомной ДНК является требованием для трансформированного фенотипа (8). Более того, исследования также показали, что ядрышко является ключевым элементом в регуляции клеточного ответа на стресс и непосредственно участвует в регуляции активности опухолевого супрессора р53 в ответ на стресс (8, –12).Расширение нашего понимания пути биогенеза рибосом имеет важное значение для разработки новых терапевтических средств против рака и лечения рибосомопатий.

Большая часть того, что известно о биогенезе эукариотических рибосом, основано на обширных исследованиях почкующихся дрожжей Saccharomyces cerevisiae (недавно рассмотрено в Ref. 4). Хотя общий процесс считается хорошо сохраненным среди эукариот, о биогенезе рибосом у высших организмов известно гораздо меньше (14).Один комплекс, который хорошо охарактеризован как в клетках дрожжей, так и в клетках млекопитающих, представляет собой комплекс PeBoW (комплекс Nop7 в S. cerevisiae ). Комплекс PeBoW был назван в честь сборочных белков млекопитающих Pes1 (Pescadillo), Bop1 (блокировка пролиферации) и WDR12 (повторяющийся домен 12 WD), тогда как гомологами дрожжей являются Nop7, Erb1 и Ytm1, соответственно. Нокдаун любого из белков в комплексе PeBoW млекопитающих блокирует процессинг большой субъединицы 32S пре-РНК и запускает p53-зависимую остановку клеточного цикла (15, 16).Точно так же у дрожжей Nop7, Erb1 и Ytm1 являются важными белками, необходимыми для процессинга пре-рРНК 27SA 3 (17, 18). Считается, что все компоненты комплекса PeBoW / Nop7 являются многофункциональными белками и связаны с ролями в различных клеточных процессах, включая репликацию ДНК, регуляцию клеточного цикла и сердечную функцию в дополнение к биогенезу рибосом (19, 20). Считается, что комплекс PeBoW / Nop7 в первую очередь локализуется в ядрышке. Этот комплекс не обнаруживается на рибосомных частицах в нуклеоплазме или цитоплазме, что указывает на то, что комплекс PeBoW должен высвобождаться из прерибосомных частиц до их транспорта из ядрышка (16, 18, 21).

Одним из способов высвобождения факторов созревания рибосом из прерибосомных частиц является помощь трех различных ААА-АТФаз, Rea1 / мидазина, Rix7 и Drg1 / Afg2, которые все используют как связывание нуклеотидов, так и гидролиз, чтобы управлять высвобождением отдельных рибосом. факторы созревания (см. 22). Rea1 отвечает за высвобождение как комплекса Nop7, так и фактора созревания Rsa4 из частиц до 60S в S. cerevisiae . Rea1 – самый крупный белок в S.cerevisiae и содержит N-концевой домен, шесть сцепленных доменов АТФазы, линкерный домен 260 кДа и C-концевой домен MIDAS, который хорошо консервативен у всех эукариот (23). Электронно-микроскопические исследования показывают, что Rea1 имеет большой моторный домен AAA, связанный с гибкой хвостоподобной структурой, которая содержит домен MIDAS на конце (24). Электронно-микроскопические исследования также показывают, что Rea1 контактирует с прерибосомными частицами, соседними с субкомплексом Rix1-Ipi1-Ipi3, причем хвост может достигать прерибосомного фактора Rsa4 (24).Дальнейшие исследования на S. cerevisiae продемонстрировали, что Rea1 и Rsa4 взаимодействуют друг с другом in vivo и in vitro через домен MIDAS Rea1 и консервативный N-концевой домен UBL Rsa4, который ранее назывался MIDO (MIDAS-взаимодействующий) домен (24). Взаимодействие между Rea1 и Rsa4 в сочетании с гидролизом АТФ запускает высвобождение Rsa4 из прерибосомных частиц, вероятно, за счет крупномасштабных механических конформационных изменений (22, 24).Гомолог Rsa4 у млекопитающих называется Notchless (Nle1) и был назван так потому, что он является прямым регулятором сигнального пути Notch в Drosophila melanogaster в дополнение к его роли в созревании рибосом (25).

Помимо управления высвобождением Rsa4, Rea1, как было показано, также управляет высвобождением комплекса Nop7 из ядрышковых прерибосомных частиц в S. cerevisiae . Биоинформатический анализ показал, что N-концевой домен UBL Rsa4 гомологичен N-концевому домену UBL Ytm1, что позволяет предположить, что Rea1 может взаимодействовать с Ytm1 через его домен MIDAS (21).Более ранние работы на мышах также показали, что N-концевой домен WDR12 обнаруживает сходство с N-концевым доменом Nle1, и первоначально он упоминался в литературе как домен Nle1 (26). Последующие эксперименты на S. cerevisiae продемонстрировали, что Ytm1 взаимодействует с Rea1 через свой домен UBL. Это взаимодействие необходимо для более ранней стадии пути созревания 60S, и в сочетании с гидролизом АТФ оно стимулирует высвобождение комплекса Nop7 из прерибосомных частиц (21).Следовательно, Rea1 способен действовать на два разных субстрата на двух разных стадиях сборки большой рибосомной субъединицы, включая ядрышковый комплекс Nop7 и нуклеоплазматический Rsa4 (22).

Здесь мы представляем кристаллическую структуру UBL домена S. cerevisiae гомолога WDR12 (Ytm1), которая показала, что он структурно гомологичен UBL домену Rsa4 / Nle1. Мы демонстрируем, что мидазин и WDR12 человека, а также мидазин и Nle1 взаимодействуют через свои домены MIDAS и UBL, соответственно.Взаимодействие между доменами MIDAS и UBL напоминает связывание лиганда рецептора интегрина и зависит от координации иона металла. Однако домен MIDAS мидазина также содержит хорошо консервативную область удлинения, которая, как мы показываем, необходима для связывания WDR12 и Nle1. Мы также продемонстрировали, что ядрышковая локализация WDR12 в клетках U2OS зависит от активной транскрипции рРНК и что мидазин преимущественно локализуется в нуклеоплазме. Взятые вместе, наши данные раскрывают первую часть структурной информации для WDR12 и подтверждают, что взаимодействия между midasin с UBL доменами WDR12 и Nle1 являются важными эволюционно законсервированными взаимодействиями в пути сборки рибосом.

Экспериментальные процедуры

Реагенты

Нормальные кроличьи IgG-антитела против мидазина и WDR12 для использования в иммуногистохимии были получены от Sigma. Нормальные мышиные антитела, конъюгированные с пероксидазой хрена против GST (B-14) и His (h4) для использования в вестерн-блоттинге, были получены от Santa Cruz Biotechnology. Моноклональные мышиные антитела против пептида Strep-Tag и нормальные кроличьи антитела против актина для использования в качестве первичных антител в вестерн-блоттинге были получены от Novagen и Sigma-Aldrich, соответственно.Козьи антитела против кроличьего IgG и антитела против мышиного IgG, конъюгированные с пероксидазой хрена для использования в качестве вторичных антител в вестерн-блоттинге, были получены от Sigma-Aldrich (против кролика) и Millipore (против мыши). Козьи антитела против кроличьего IgG с конъюгатом Alexa Fluor 633 для флуоресценции были получены от Molecular Probes, Inc. Нормальная козья сыворотка была получена от Santa Cruz Biotechnology, Inc. Актиномицин D, параформальдегид и бычий сывороточный альбумин были получены от Sigma-Aldrich. 4 ‘, 6-Диамидино-2-фенилиндол (DAPI) был приобретен у Life Technologies, Inc.

Клонирование, экспрессия белка и очистка белка UBL-домена Ytm1

Остатки 1–94 S. cerevisiae Ytm1 амплифицировали с помощью ПЦР из геномной ДНК и вставляли в параллельный вектор pGST2 между сайтами рестрикции BamHI и NotI ( 27). Плазмиду Ytm1-UBL трансформировали в звездчатые клетки BL21 (DE3) (Life Technologies). Клетки выращивали в присутствии 100 мкг / мл ампициллина в бульоне LB при 37 ° C до A 600 0,6, а затем экспрессию белка индуцировали с помощью 0.9 мМ изопропил-β-d-тиогалактопиранозид в течение 3 ч при 37 ° C. Клетки собирали и затем замораживали при -20 ° C до дальнейшего использования. Клетки ресуспендировали в буфере для лизиса (50 мМ Трис, pH 8,0, 500 мМ NaCl, 10 мМ MgCl 2 , 0,01% Triton X-100), содержащем одну таблетку ингибитора протеазы без ЭДТА (Roche Applied Science), и лизировали ультразвуком при 4 ° С. Осветленный лизат наносили на колонку с гравитационным потоком, содержащую 5 мл смолы GST (GE Healthcare), и инкубировали в течение 1 ч при 4 ° C. Несвязанный белок удаляли последовательными промываниями буфером для лизиса, и белок элюировали 20 мл элюирующего буфера (50 мМ глутатиона, 50 мМ Tris, pH 8, 200 мМ NaCl).Затем образец концентрировали и пропускали через колонку для исключения размера Superdex 75 16/600 (GE Healthcare), предварительно уравновешенную 20 мм Трис, pH 8, 200 мм NaCl, 0,1 мм трис (2-карбоксиэтил) фосфина. Фракции, содержащие домен UBL с GST-меткой, объединяли, а затем GST-метку расщепляли в течение ночи при 4 ° C протеазой вируса травления табака. Затем отщепленный образец снова пропускали через колонку исключения размера Superdex 75 16/600 для удаления GST и любого нерасщепленного белка. Фракции, содержащие домен UBL, концентрировали до 14.4 мг / мл и сразу использовали для кристаллизации. Включение селенометионила (SeMet) достигалось путем экспрессии домена UBL в звездчатых клетках BL21 (DE3), выращенных в минимальной среде M9, дополненной SeMet. Домен SeMet UBL очищали, как описано выше, и включение SeMet проверяли масс-спектрометрией.

Кристаллизация UBL-домена

UBL-домен Ytm1 кристаллизовали диффузией паров висячей капли с использованием равных объемов белка и раствора лунок, содержащего 0.1 м какодилата натрия, pH 6,2–6,8 и 0,9–1,2 моль цитрата натрия. Кристаллы росли в виде кластеров пластинок за 2–3 дня. Качество кристаллов было улучшено за счет нескольких раундов микропосевания с помощью затравочных гранул (Hampton Research) с получением кристаллов на одной пластине с размерами до 200 × 200 × 50 мкм. Кристаллы подвергали криозащите путем поэтапного добавления этиленгликоля до конечной концентрации 35% (об. / Об.) И затем мгновенно замораживали в жидком азоте.

Сбор данных и определение структур Линия пучка SER-CAT 22-BM (Чикаго, Иллинойс).Кристаллы находятся в пространственной группе P1 с двумя копиями в асимметричном блоке. Структура была первоначально решена путем молекулярной замены с использованием модели гомологии, полученной из структуры домена UBL Rsa4 (запись в банке данных белков 4WJS) в программе MRage (28). Bucanneer (29) был использован для построения модели, после чего последовало несколько раундов ручного построения модели с COOT и уточнения с Phenix (28). Чтобы подтвердить, что назначение основной цепи было правильным, мы использовали фазы молекулярного замещения для расчета карты аномальных различий из набора данных SeMet, которая подтвердила правильное размещение двух остатков Met.Структура была уточнена до окончательной
R работы / R бесплатно 17,5% / 23,2%.

Анализ роста дрожжей

Штаммы S. cerevisiae , использованные в исследовании, перечислены в. Родительские штаммы tetO 7 были получены от Open Biosystems. Ytm1 вместе с его эндогенным промотором были амплифицированы с помощью ПЦР из геномной ДНК S. cerevisiae и клонированы в центромерную плазмиду YCplac111 (30). Мутации Ytm1 были созданы с использованием мутагенеза QuikChange, и все мутации были проверены путем секвенирования.Для проведения анализов посева на разведение клетки выращивали в YPD, а затем разводили до 0,05 A 600 . Затем последовательные разведения 1:10 высевали на планшеты YPD с 10 мкг / мл доксициклина и без него и инкубировали при 20, 30 и 37 ° C в течение 3 дней.

ТАБЛИЦА 2

Штаммы дрожжей, использованные в этом исследовании

Штамм Генотип Источник
tetO 7 -Ytm1 -tetO 7 TATA MATa his3-1 leu2-0 met15-0 Открытые биосистемы
tetO 7 -Ytm1 + Ytm1-ycplac111 URA :: CMV-tTA Ytm1 :: kanR-tetO TATA MATa his3-1 leu2-0 met15-0; ycplac111-Ytm1 Это исследование
tetO 7 -Ytm1 + ycplac111 URA :: CMV-tTA Ytm1 :: kanR-tetO 7 TATA MATa his3-1 leu2-0 met15-0; ycplac111 Это исследование
tetO 7 -Ytm1 + Ytm1E80A URA :: CMV-tTA Ytm1 :: kanR-tetO 7 TATA MATa his3-1 leu2-0 met15-0; ycplac111-Ytm1E80A Это исследование
tetO 7 -Ytm1 + Ytm1E86A URA :: CMV-tTA Ytm1 :: kanR-tetO 7 TATA MATa his3-1 leu2-0 met ycplac111-Ytm1E86A Это исследование
tetO 7 -Ytm1 + Ytm1R65A URA :: CMV-tTA Ytm1 :: kanR-tetO 7 TATA MATa his3-1 leu2-0 met ycplac111-Ytm1R65A Это исследование
tetO 7 -Ytm1 + Ytm1L58S URA :: CMV-tTA Ytm1 :: kanR-tetO 7 TATA MATa his3-1 leu2-0 met ycplac111-Ytm1 L58S Это исследование
tetO 7 -Ytm1 + Ytm1F57S URA :: CMV-tTA Ytm1 :: kanR-tetO 7 TATA MATa his3-1 leu2-0 met ycplac111-Ytm1 F57S Это исследование
tetO 7 -Ytm1 + Ytm1F57S L58S URA :: CMV-tTA Ytm1 :: kanR-tetO 7 TATA MATa his3-1 leu; ycplac111-Ytm1 F57S L58S Это исследование
Трансфекция млекопитающих и анализ GST Pull-down

Полноразмерные человеческие Bop1 и Pes1 были амплифицированы из кДНК (Open Biosystems) и клонированы в один из векторов pLexM (31). N-концевую метку His 12 или N-концевую метку GST.ДНК, кодирующая остатки 5287–5596, которая включает домен MIDAS человеческого мидазина, была оптимизирована по кодонам для экспрессии в клетках HEK293 и клонирована в вектор pLexM, кодирующий N-концевую метку GST, и вектор pCAG-OSF (32), кодирующий N-концевой тег OSF (One-Strep-FLAG). Полноразмерный человеческий WDR12 и Nle1 клонировали в вектор pCAG-OSF, кодирующий N-концевую метку OSF. Для создания WDR12ΔUBL остатки 84–423 WDR12 амплифицировали с помощью ПЦР из кДНК, кодирующей WDR12, и клонировали в вектор pCAG-OSF.Для создания Nle1ΔUBL остатки 100-485 Nle1 амплифицировали с помощью ПЦР из кДНК, кодирующей Nle1, и клонировали в вектор pCAG-OSF. Мутации вводили с помощью мутагенеза QuikChange (Stratagene). 40 мл культур клеток HEK293, адаптированных для роста в суспензии, трансфицировали 1 мкг / мл очищенной плазмидной ДНК и 2 мкг / мл PEI. Клетки собирали через 72 часа после трансфекции, промывали PBS и замораживали при -80 ° C до дальнейшего использования. Клетки лизировали путем ресуспендирования в буфере для лизиса (50 мМ Трис, pH 7,4, 500 мМ NaCl, 10 мМ MgCl 2 , 10% (об. / Об.) Глицерина, 1% (об. / Об.) Тритон X-100, EDTA- свободные ингибиторы протеаз (Roche Applied Science) и 10 единиц бензоназы (Sigma) с осторожным покачиванием при 4 ° C в течение 1 часа.Лизаты осветляли центрифугированием, а затем инкубировали со 100 мкл глутатионовой смолы (GE Healthcare) в течение 1 ч при 4 ° C. Несвязанный белок удаляли тремя промывками по 200 мкл буфером для лизиса, затем двумя промывками по 200 мкл буфером для лизиса, включая 5 мМ АТФ, и последующей последней промывкой 200 мкл буфером для лизиса. Белок, который оставался на смоле, анализировали как с помощью SDS-PAGE, так и вестерн-блоттинга.

Вестерн-блоттинг

Белки разделяли на 4–15% -ных гелях Mini-PROTEAN TGX Stain-Free (Bio-Rad) и переносили на поливинилидендифторидные мембраны (Bio-Rad).После переноса мембраны блокировали на несколько часов в 5% (мас. / Об.) Обезжиренном молоке в трис-буферном физиологическом растворе, 0,1% Tween 20 (TBST). Затем мембраны инкубировали в течение ночи при 4 ° C либо с антителом, конъюгированным с GST (B-14) и HRP (разведение 1: 200), либо с антителом, конъюгированным с His (h4) HRP (разведение 1:50), или с антителом против Strep. -Tag первичное антитело (разведение 1: 1000) или первичное антитело против актина (разведение 1: 100) в 5% (мас. / Об.) Обезжиренном молоке и 1% (мас. / Об.) Бычьем сывороточном альбумине в TBST. После инкубации в течение ночи мембраны трижды тщательно промывали TBST.Мембраны, требующие вторичных антител для визуализации, затем инкубировали либо с козьими антимышиными IgG (разведение 1:10 000), либо с козьими антителами против кроличьих IgG (разведение 1: 80 000), конъюгированными с HRP-антителами в 5% (мас. / Об.) Обезжиренном молоке. и 1% (мас. / об.) бычьего сывороточного альбумина в TBST и инкубировали не менее 1 ч при комнатной температуре. После инкубации мембраны снова трижды тщательно промывали TBST. Полосы белка визуализировали с помощью реагента для обнаружения вестерн-блоттинга ECL Plus (GE Healthcare).

Клеточные культуры

Клетки U2OS культивировали в модифицированной по Дульбекко среде Игла с высоким содержанием глюкозы с добавлением 10% (об. / Об.) Фетальной бычьей сыворотки, антибиотиков (100 единиц / мл пенициллина и 100 мкг / мл стрептомицина) и 2 мМ глутамина. Клетки инкубировали при 37 ° C в инкубаторе CO 2 .

Иммуногистохимия / флуоресценция

Клетки U2OS культивировали на 35-миллиметровых чашках для культивирования со стеклянным дном (MatTek Corp.) до достижения 80–100% конфлюэнтности. Среда была отброшена; клетки промывали 1 × PBS, pH 7.4; клетки фиксировали в 3-4% растворе параформальдегида в 1 × PBS в течение 1 ч. Раствор параформальдегида удаляли, клетки промывали 1 × PBS и клетки пропускали через 0,5% Triton X-100, 1 × PBS (Sigma-Aldrich) в течение 1,5 часов. Затем клетки промывали трижды (каждая по 10 мин) 1 × PBS. Затем клетки инкубировали в течение минимум 1,5 ч с блокирующим буфером (1% бычий сывороточный альбумин, 4% нормальная козья сыворотка и 0,4% Triton X-100 в 1 × PBS). Затем удаляли блокирующий буфер и клетки инкубировали в течение ночи при 4 ° C с первичным антителом от Sigma в разведениях, рекомендованных производителем.Затем клетки промывали три раза (по 10 мин каждая) 1 × PBS, а затем защищали от света и инкубировали с вторичными антителами Alexa Fluor в течение 1 ч в разведениях, рекомендованных производителем. Затем клетки снова промывали 1 × PBS, как описано ранее. Наконец, клетки инкубировали с 300 нм DAPI, промывали один раз 1 × PBS, а затем покрывали 1 × PBS и визуализировали с помощью эпифлуоресцентного микроскопа Zeiss Axio Observer Z1 с объективом Zeiss EC Plan-Neofluar 40 × / 0,9 и апертурной линзой.Конъюгированный флуорохром Alexa Fluor 633 был получен при комнатной температуре на камере Zeiss AxioCam MRm с помощью программного обеспечения Zen Pro 2012 (Blue Edition) и обработан с помощью ImageJ.

Результаты

Структура домена UBL S. cerevisiae Ytm1

Для дальнейшего изучения структуры Ytm1 / WDR12 ( A ) мы определили кристаллическую структуру домена UBL (плотность была видна для остатков 5–91 ) Ytm1 из S. cerevisiae с разрешением 1,7 Å ( B ).Структура была решена путем молекулярной замены недавно опубликованным UBL-доменом Rsa4 (запись в банке данных белков 4WJS (33)) в качестве модели поиска, и назначение основной цепи было подтверждено расчетом карты аномальных различий для производного метионина селена. Структура была уточнена до R работы / R бесплатно 17,5% / 23,2% (см. C для репрезентативной части несмещенной электронной плотности; для дальнейшего сбора данных и статистики кристаллографии см.).Есть две почти идентичные копии домена в асимметричной единице, но нет доказательств, позволяющих предположить, что домен образует димер в растворе или in vivo . Структура показала, что UBL-домен Ytm1 имеет классическую компактную убиквитиновую β-складку, состоящую из четырех β-тяжей, которые образуют центральный β-лист, и двух α-спиралей, расположенных на одной стороне β-листа ( B ).

Кристаллическая структура домена UBL из S. cerevisiae Ytm1. A , доменная диаграмма Ytm1 и WDR12. Номера , наверху , соответствуют аминокислотным остаткам из S. cerevisiae Ytm1, а номера , внизу , соответствуют аминокислотным остаткам из Homo sapiens WDR12. B , ленточная диаграмма UBL-домена S. cerevisiae Ytm1. Помечен N-конец белка, а также С-конец домена, который ведет к домену WD40.Остаток Glu 80 , который, как полагают, координирует ион металла с доменом MIDAS Rea1, показан в виде стержня . C , составная карта исключения, показывающая репрезентативную электронную плотность структуры с разрешением 1,7 Å между остатками Glu 86 и Thr 88 . Карта была оконтурена на 1,7 σ.

ТАБЛИЦА 1

Статистика сбора и уточнения данных

Статистика для оболочки высокого разрешения показана в скобках.

3 бесплатно работа (%) участок
Исходный UBL UBL SeMet
Сбор данных
SET Длина луча 9014 CAT3 SER- Å) 1,0000 0,9649
Диапазон разрешения (Å) 50–1,70 (1,76–1,70) 50,00–1,91 (1,98–1,91)
Космическая группа P
Размеры ячейки
a , b , c (Å) 35.299, 37.742, 41.135 37.525, 35.067, 41.012
α, β, γ (градусы) 82.542, 64.309, 69.619 64.395, 82.480, 69.558
(4136 Всего отражений) 40,477 (3359)
Уникальные отражения 18,667 (1654) 12,086 (1244)
Полнота (%) 95,3 (85,4) 87,5 (88143) Среднее значение / σ 8.2 (2,5) 14,2 (2,7)
Кратность 2,5 (2,0) 3,3 (2,7)
R слияние (%) 9,1 (34,4) 9,0 ( 35,4)

Уточнение
Диапазон разрешения (Å) 50–1,70
17.5 / 23,2
Среднеквадратичное отклонение
Длина связки (Å) 0,0058
Углы наклона скобы (Å)
Наиболее предпочтительный (%) 96,5
Допускаемый дополнительный (%) 2.94
Запрещено (%) 0,6
Фактор Уилсона B 2 ) 28,96

Несмотря на небольшую гомологию последовательностей между доменами UBL Rsa4 и Ytm1 ( B ), структуры двух доменов хорошо накладываются друг на друга со среднеквадратичным отклонением 4.5 Å более 80 остатков Cα ( A ). И Rsa4, и Ytm1 содержат хорошо консервативные остатки глутамата, которые, как полагают, координируют ион металла с доменом MIDAS Rea1 в S. cerevisiae (21, 24). Консервативный остаток глутамата (остаток Glu 80 в S. cerevisiae ) в Ytm1, важный для связывания домена MIDAS Rea1, находится в расширенной петле перед конечной β-цепью в том же структурном месте, что и консервативный глутамат в Rsa4 ( B и A ).Поиск на сервере Dali показал, что UBL-домен Ytm1 наиболее похож на ассоциированный с аутофагией убиквитин-подобный белок, Atg12, и убиквитин-протеин-лигазу E3, RING2, что подчеркивает диапазон разнообразия биологической активности UBL-доменов. UBL-домен Ytm1 также достаточно хорошо накладывается на убиквитин (запись в банке данных белков 1UBQ) со среднеквадратичным отклонением 5,5 Å по 71 остатку Cα ( C ). В целом, учитывая структурное сходство между Rsa4 и Ytm1 вместе с перекрывающимися остатками глутамата, Rea1 несомненно взаимодействует с обоими белками аналогичным образом.

Сравнение доменов UBL из Ytm1 / WDR12 и Rsa4 / Nle1. A , выравнивание кристаллических структур доменов UBL из S. cerevisiae Ytm1 ( пурпурный ) и C. thermophilum Rsa4 ( розовый ; запись в банке данных белков 4WJS). B , множественное выравнивание последовательностей из UBL-доменов Ytm1 / WDR12 и Rsa4 / Nle1 из разных гомологов Homo sapiens ( H.s. ), Mus musculus ( M.м. ), D. melanogaster ( D.m. ), Caenorhabditis elegans ( C.e. ), C. thermophilum ( C.t. ) и S. cerevisiae ( S.c. ). C , выравнивание кристаллической структуры домена UBL из S. cerevisiae Ytm1 ( пурпурный ) с убиквитином ( желтый ; запись в банке данных белков 1UBQ). Остатки Phe 57 и Leu 58 Ytm1 показаны в виде голубых палочек.D , анализ роста дрожжей мутантов Ytm1 UBL. Трансформанты наносили в 10-кратных серийных разведениях на планшеты YPD в присутствии или в отсутствие 10 мкг / мл доксициклина для уменьшения экспрессии эндогенного Ytm1 и выращивали при 20, 30 и 37 ° C в течение 3 дней.

Мутации в UBL-домене Ytm1 вызывают дефекты роста у дрожжей

UBL-домен Ytm1 важен для жизнеспособности в S. cerevisiae и содержит много хорошо законсервированных остатков ( B ). Ранее он был показан в S.cerevisiae , что усечение домена UBL или мутация остатка E80A в дрожжах является летальной (18, 21). Однако в домене UBL есть много других хорошо законсервированных остатков. Чтобы определить, какие из этих остатков важны для жизнеспособности клеток, мы внесли мутации в домен UBL и протестировали их влияние на рост. Мы трансформировали плазмиды, кодирующие Ytm1 дикого типа или мутантный Ytm1, в клетки, несущие эндогенный Ytm1 под промотором Tet (Hughes Tet-Promoter Collection, Open Biosystems), и анализировали на рост в присутствии и в отсутствие 10 мкг доксициклина при 20, 30 и 37 °. C (см. Список штаммов дрожжей, использованных в этом исследовании).Добавление доксициклина выключает экспрессию эндогенного Ytm1. Мутацию E80A использовали в качестве положительного контроля, и, как ожидалось, как истощение эндогенного Ytm1, так и экспрессия мутанта E80A вызывали серьезный дефект роста по сравнению с ростом плазмиды, экспрессирующей Ytm1 дикого типа ( D ). Неожиданно мутация хорошо законсервированных остатков Arg 65 и Glu 86 до аланина не оказала влияния на рост дрожжей, что указывает на то, что они не являются существенными для функции ( D ).

Учитывая высокое структурное сходство между доменом UBL Ytm1 и убиквитином, мы предположили, что Ytm1 может содержать существенный гидрофобный участок, необходимый для функционирования. В убиквитине хорошо установлено, что остаток Ile 44 образует часть существенного гидрофобного участка вместе с остатками Leu 8 и Val 70 , который важен для поддержания взаимодействий с α-спиральными убиквитин-ассоциированными доменами, такими как S5a. протеасомы 26S (34).Есть два хорошо законсервированных гидрофобных остатка в Ytm1, Phe 57 и Leu 58 , которые накладываются рядом с Ile 44 в убиквитине ( C ). Индивидуальная мутация Phe 57 или Leu 58 в серин не была летальной для дрожжей, но двойной мутант F57S / L58S вызывал серьезный дефект роста у дрожжей, который сравним с истощением эндогенного белка ( D ), предполагая, что удержание этого гидрофобного пластыря имеет решающее значение для функционирования.Phe 57 -Leu 58 в Ytm1 может быть важным для взаимодействия с другой частью мидазина и / или комплекса Rix1, который, как известно, связан с прерибосомными частицами мидазина (24, 35).

Мидазин человека связывает WDR12 через свой домен UBL

После выяснения кристаллической структуры домена UBL Ytm1 мы исследовали функцию домена UBL WDR12 в клетках млекопитающих и продемонстрировали, что он необходим для связывания мидазина. Предыдущая работа показала, что WDR12ΔUBL ингибирует пролиферацию клеток, запускает накопление p53 и нарушает процессинг рРНК, указывая на то, что домен UBL WDR12 важен для биогенеза рибосом млекопитающих (15).Учитывая важность домена UBL в клетках млекопитающих, мы предположили, что WDR12 связывается с мидазином через свой домен UBL, как и его дрожжевой аналог. Чтобы определить, являются ли мидазин и WDR12 партнерами по связыванию, клетки HEK293 трансфицировали плазмидами, содержащими человеческий мидазин и человеческий WDR12, и анализировали на связывание с помощью GST pull-down ( A ). Наша исходная конструкция для домена MIDAS мидазина была основана на эквивалентных остатках, используемых для выполнения in vitro извлечения с гомологами дрожжей (21).Меченные GST остатки 5287–5596 мидазина, которые включали полный домен MIDAS и около 100 остатков выше домена MIDAS, были способны разрушать полноразмерный WDR12, но не WDR12ΔUBL ( B ). Экспрессия WDR12 и WDR12ΔUBL была подтверждена вестерн-блоттингом, и полноразмерный WDR12 не взаимодействует с GST-связанной глутатионовой смолой в отсутствие мидазина ( B ). Следовательно, домен WDR12 UBL необходим для взаимодействия с мидазином.

Мидазин человека связывает WDR12 и Nle1 через их домены UBL. A , схематическая диаграмма конструкций WDR12, Nle1, midasin, Pes1 и Bop1, используемых для анализа GST pull-down. H , его тег; S , метка One-Strep-FLAG; Ext , регион расширения Midas. B , домен UBL WDR12 необходим для связывания мидазина. Клетки HEK293 трансфицировали плазмидами, несущими GST-мидазин-MIDAS и OSF-WDR12 с доменом UBL и без него. Выпадение GST анализировали с помощью вестерн-блоттинга. C , домен UBL WDR12 не требуется для формирования комплекса PeBoW.Клетки HEK293 трансфицировали плазмидами, несущими GST-Bop1, His-Pes1, OSF-WDR12 с доменом UBL и без него и OSF-мидазином. D , домен UBL Nle1 необходим для связывания мидазина. Клетки HEK293 трансфицировали плазмидами, несущими GST-мидазин MIDAS и OSF-Nle1 с доменом UBL и без него. WCL , лизат цельных клеток.

Мидазин связывает комплекс PeBoW через домен UBL WDR12

После демонстрации того, что WDR12 связывается с мидазином через свой домен UBL, мы хотели определить, как мидазин взаимодействует с комплексом PeBoW.Сначала мы трансфицировали клетки HEK293 плазмидами, несущими полноразмерный GST-меченый Bop1 в качестве приманки, полноразмерный Pes1 и полноразмерный WDR12 или WDR12ΔUBL, чтобы определить, какое влияние UBL-домен WDR12 оказывает на образование комплекса PeBoW. Мы провели анализ связывания с помощью GST-pull-down с последующим вестерн-блоттингом, который показал, что домен UBL WDR12 не требуется для образования комплекса PeBoW ( C ). Мы действительно наблюдаем различия в количестве вытягиваемого WDR12. Однако, если мы нормализуем все до количества Bop1, которое использовалось в качестве приманки, уровни Pes1 и WDR12 довольно однородны.Все наши исследования проводились на клетках, которые были временно трансфицированы несколькими плазмидами, поэтому мы связываем эти различия с уровнями эффективности трансфекции.

После того, как мы подтвердили, что домен UBL WDR12 не требуется для образования комплекса PeBoW, мы рассмотрели связывание с мидазином. Клетки HEK293 трансфицировали плазмидами, несущими полноразмерный GST-меченный Bop1 в качестве приманки, полноразмерный Pes1, полноразмерный WDR12 или WDR12ΔUBL и остатки 5287-5596 мидазина. GST-tagged Bop1 был способен разрушить MIDAS-домен midasin только в присутствии полноразмерного WDR12 ( C ).Следовательно, мидазин может взаимодействовать только с WDR12 и внутри комплекса PeBoW; однако оба взаимодействия зависят от домена UBL WDR12.

Человеческий мидазин связывает Nle1 через свои UBL-домены

Мы также продемонстрировали, что человеческий Nle1 также связывается с мидазином через свой UBL-домен. Поскольку мы показали, что домены UBL дрожжевых гомологов Nle1 (Rsa4) и WDR12 (Ytm1) структурно гомологичны ( A ), мы предположили, что Nle1 также будет связывать мидазин через его домен UBL в клетках млекопитающих.Ранее было показано, что Nle1 связывается с midasin / Rea1 у нескольких организмов, включая S. cerevisiae и Solanum chacoense (24, 36). Чтобы определить, являются ли мидазин и Nle1 млекопитающих партнерами по связыванию, мы трансфицировали клетки HEK293 плазмидами, кодирующими остатки 5287-5596 мидазина и Nle1 с доменом UBL или без него, и проанализировали связывание с помощью GST pull-down. Меченные GST остатки 5287–5596 мидазина были способны сбрасывать полноразмерный Nle1, но не Nle1ΔUBL ( D ).Экспрессия как Nle1, так и Nle1ΔUBL была подтверждена вестерн-блоттингом, и полноразмерный Nle1 не взаимодействует с GST-связанной глутатионовой смолой в отсутствие мидазина ( B ). Наши результаты подтверждают, что, как и у дрожжей, мидазин млекопитающих способен связывать как WDR12, так и Nle1 через их соответствующие домены UBL.

Область расширения домена Midasin MIDAS необходима для связывания WDR12 и Nle1

После подтверждения того, что мидазин связывается как с WDR12, так и с Nle1, мы картировали интерфейс связывания между белками и обнаружили, что мидазин содержит хорошо консервативную область, необходимую для связывания. WDR12 и Nle1.Прямо перед консенсусным мотивом MIDAS находится область, которая является высококонсервативной (инвариантной на 46%) в мидазине ( A ) и, по прогнозам, является α-спиральной, но не имеет значительной гомологии с другими известными белками (23). В оставшейся части статьи он будет называться областью расширения MIDAS. Мы предположили, что, учитывая его высокую консервативность последовательности, область удлинения MIDAS д. Играть важную роль в функции мидазина и может быть важна для связывания WDR12 и Nle1.Чтобы проверить эту гипотезу, была создана серия N-концевых усечений области удлинения MIDAS и затем проанализирована связь с WDR12 и Nle1 с помощью GST pull-down. Начиная с усечения мидазина 5310–5596, мы видим уменьшенную способность WDR12 связываться с мидазином ( B ). N-концевые усечения за остатком 5320 не смогли опустить WDR12, что указывает на то, что вся область удлинения MIDAS требуется для связывания WDR12 ( B ). Учитывая, что область удлинения не является частью канонической консенсусной последовательности MIDAS, взаимодействие между мидазином и WDR12 должно требовать большего, чем типичный интерфейс MIDAS / лиганд иона металла.Мы повторили тот же эксперимент с Nle1 и получили аналогичные результаты ( C ), указывающие на важность области удлинения MIDAS мидазина для связывания как Nle1, так и WDR12.

Область расширения MIDAS мидазина необходима для связывания WDR12. A , множественное выравнивание последовательностей домена MIDAS и ∼100 остатков выше домена MIDAS мидазина от различных гомологов H. sapiens ( H.s. ), M. musculus ( M.м. ), D. melanogaster ( D.m. ), C. elegans ( н.э. ) и S. cerevisiae ( S.c. ). Предсказанная вторичная структура домена MIDAS, основанная на выравнивании вторичных структур в HHPRED, показана под последовательностью, а номера внизу первой строки соответствуют последовательности мидазина H. sapiens . Консенсусная последовательность иона металла в доменах MIDAS состоит из следующего: hhhhD X S X S, за которым следует консервативный треонин в ~ 70 остатках и hhhh (S / T) DG в ~ 30 остатках, где h равен любой гидрофобный и X – любой остаток (23, 37).Остатки консенсусной последовательности MIDAS указаны как над последовательностью . B , Вестерн-блот-анализ GST-фрагментов N-концевых усечений MIDAS с помощью WDR12. Используемые конструкции содержали следующие остатки мидазина, слитые с N-концевой GST-меткой: 5287 (остатки 5287–5596), 5300 (остатки 5300–5596), 5310 (остатки 5310–5596), 5320 (остатки 5320–5596), и 5530 (остатки 5530–5596). C , Вестерн-блот-анализ GST усечений MIDAS с помощью Nle1. WCL , лизат цельных клеток.

Glu
78 WDR12 требуется для связывания Midasin

Мы картировали интерфейс между midasin и WDR12 и подтвердили, что консервативный глутамат, остаток Glu 78 WDR12 (Glu 80 в S. cerevisiae Ytm1) , требуется для связывания мидасина. Мутация либо консервативных остатков аспарагиновой кислоты в консенсусном мотиве MIDAS, либо консервативного глутамата в доменах UBL Ytm1 и Rsa4 устраняет взаимодействия между мидазином и Ytm1 / Rsa4 у дрожжей (21, 24).Чтобы определить, верно ли это и для клеток млекопитающих, мы мутировали соответствующий глутамат в WDR12 (Glu 78 ) на аланин и обнаружили, что мутация E78A не способна связывать домен MIDAS мидазина ( A ). Было показано, что мутация S78L в дрожжевом Ytm1 является синтетической летальной в сочетании с мутантом Rea1 (21). Этот остаток серина консервативен в WDR12 млекопитающих ( B ), и мутация Ser 76 в лейцин значительно снижает связывание с доменом MIDAS мидазина ( A ).Однако мутация Ser 76 на остаток глутамата не влияла на связывание с мидазином ( A ). Выравнивание последовательностей WDR12 у многих видов ( B ) показало, что высшие организмы имеют небольшую вставку в петлю, следующую за первой α-спиралью, а делеция остатков 47-50 WDR12 млекопитающих также значительно снижает связывание с доменом MIDAS мидазина ( А ). Мы также мутировали консервативные остатки аспарагиновой кислоты в рамках консенсусного мотива MIDAS в мидазине, но не смогли определить, отменяют ли они связывание WDR12, потому что мы не смогли обнаружить экспрессию мутанта двойной аспарагиновой кислоты midasin-MIDAS при трансфекции в клетки HEK293.

Ион металла необходим для связывания WDR12 и мидазина. A , Вестерн-блоттинг анализ GST с мутациями UBL WDR12. B , модель взаимодействия мидазина ( синий, ) и UBL-доменом WDR12 ( фиолетовый, ). Модель гомологии мидазина была создана на основе кристаллической структуры интегрина αLβ2 (запись в банке данных белков 1T0P). Остатки, важные для координации иона металла ( красный, ), показаны в виде стержней .C , GST-версии midasin и WDR12 с ЭДТА и без нее. Клетки лизировали в присутствии или в отсутствие EDTA, и связывание анализировали с помощью GST-анализа с последующим анализом SDS-PAGE (Simply Blue Stain (Thermo)). WCL , лизат цельных клеток.

Ион металла необходим для связывания мидазина-MIDAS и WDR12

После проверки того, что остатки, которые считаются важными для координации иона металла между мидазином и WDR12, важны для связывания, мы продемонстрировали, что образование комплекса зависит от присутствия ион металла.Домены MIDAS широко изучены в интегринах, где они играют важную роль в обеспечении связывания лиганда через координацию иона металла, который необходим для связывания лиганда (22, 37, 38). Мы создали модель гомологии для взаимодействия домена UBL WDR12 и домена MIDAS мидазина с использованием нашей структуры UBL Ytm1 для WDR12 и интегрина αLβ2 (запись в банке данных белков 1T0P) структуры домена MIDAS для мидазина ( B ).

В кристаллической структуре интегрина αLβ2, связанного с его лигандом ICAM, металл, связанный между двумя белками, представляет собой ион магния.Домен MIDAS мидазина содержит полную каноническую консенсусную последовательность MIDAS (hhhhD X S X S, ∼70 остатков T и hhhh (S / T) DG в ∼30 остатках, где h – любой гидрофобный остаток и X – любой остаток ( A )), как обнаруживается в интегрине αLβ2 (39). WDR12 и Nle1 также содержат консервативный остаток глутаминовой кислоты, такой как лиганд ICAM. Таким образом, все шесть остатков, которые координируют ион металла, сохраняются, поэтому мы полагаем, что координация иона металла будет такой же, как у интегрина αLβ2, связанного со своим лигандом ICAM.В нашей модели гомологии отсутствует область расширения MIDAS, потому что у нас нет структурной информации для этой области. Чтобы определить важность иона металла для связывания WDR12 с доменом мидазина MIDAS, мы трансфицировали клетки HEK293 плазмидами, содержащими мидазин MIDAS человека и WDR12 человека. Через 72 часа после трансфекции клетки собирали, разделяли пополам, а затем лизировали в присутствии или в отсутствие 10 мМ ЭДТА для устранения координации металлов. EDTA значительно снижает количество WDR12, которое может быть удалено с помощью GST-тегированного midasin-MIDAS ( C ).Этот результат подтверждает, что ион металла необходим для содействия образованию комплекса между доменом MIDAS мидазина и WDR12.

WDR12, но не мидазин локализуется в ядрышке в клетках U2OS

Чтобы дополнительно охарактеризовать WDR12 и мидазин млекопитающих, мы провели эксперименты по иммунофлуоресценции на клетках остеоскаркомы U2OS со специфическими антителами к WDR12 и мидазину. Эндогенный WDR12 обнаруживает заметную ядрышковую локализацию, как и ожидалось (15), тогда как эндогенный мидазин локализуется как в нуклеоплазме, так и в цитоплазме ().Интересно, что мидазин, по-видимому, также имеет заметную локализацию в определенном месте в цитоплазме, указывая тем самым, что он может выполнять дополнительные нерибосомные роли в клетке (). Локализация эндогенного WDR12 в ядрышке согласуется с его ролью на ранних стадиях биогенеза рибосом, которые происходят в ядрышке, тогда как локализация мидазина в нуклеоплазме согласуется с его ролью на более поздних стадиях биогенеза рибосом ( 40).

WDR12 требует транскрипции РНК-полимеразы I. для локализации ядрышка.Клетки U2OS фиксировали и иммуноокрашивали антителом против WDR12 ( красный, ) или антителом против мидазина ( красный, ), и ДНК визуализировали путем окрашивания DAPI ( синий, ). Клетки обрабатывали ДМСО или актиномицином D в течение 2 ч до фиксации. Масштабная линейка представляет все панели .

Затем мы хотели определить, влияет ли локализация WDR12 и мидазина клеточным стрессом и транскрипцией рРНК. Нарушение транскрипции рРНК различными клеточными стрессорами может вызвать релокализацию белков, участвующих в биогенезе рибосом (41).Например, Pes1, один из других белков, связанных с WDR12 в комплексе PeBoW, перемещается из ядрышка в нуклеоплазму при индукции клеточного стресса (42). Чтобы имитировать клеточный стресс, мы обрабатывали клетки U2OS низкой концентрацией (10 мкМ) актиномицина D для ингибирования транскрипции рРНК РНК-полимеразой I, и мы повторили наши эксперименты по иммунофлуоресценции с использованием ДМСО в качестве контроля. WDR12 теряет свою ядрышковую локализацию при обработке актиномицином D, но не только ДМСО. Вместо этого он обнаруживается в нуклеоплазме, подтверждая, что клеточный стресс влияет на локализацию WDR12 ().Напротив, нуклеоплазматическая локализация мидазина не изменилась при обработке клеток актиномицином D или ДМСО ().

Обсуждение

Для сборки эукариотических рибосом необходимы два важных белка, Ytm1 / WDR12 и Rsa4 / Nle1, которые несут в себе домены UBL, за которыми следуют С-концевые домены β-пропеллера WD40. С помощью рентгеновской кристаллографии мы определили кристаллическую структуру домена UBL дрожжевого гомолога Ytm1 / WDR12. Домены UBL имитируют свойства убиквитина за счет включения убиквитиновой β-захватывающей складки в свои белковые кодирующие области.Они используются в самых разных клеточных процессах, таких как деградация белка, репарация ДНК, деление клеток и аутофагия, и часто являются частью мотивов белок-белкового взаимодействия (34, 43, 44). WDR12 и Nle1 – единственные известные белки, содержащие домен UBL в пути сборки рибосомы. Функция этого домена состоит в том, чтобы рекрутировать хвост большого моторного белка midasin и управлять высвобождением как комплекса PeBoW, так и Nle1 из прерибосомных частиц, предположительно посредством механизмов фактор-реле, которые вызывают изменения конформации в пре-рРНК (33).Недавняя кристаллическая структура дрожжевого гомолога Rsa4 / Nle1 содержала две копии белка в асимметричной единице, и, что интересно, домен UBL в каждом имел различную ориентацию по отношению к β-пропеллеру, что позволяет предположить, что вращательная гибкость домена UBL может иметь значение для функции (33). Во время пересмотра этой рукописи другая группа опубликовала кристаллическую структуру Chaetomium thermophilium Ytm1, связанного с С-концевым концом Erb1. Как наблюдалось для Rsa4, они также обнаружили, что домен UBL Ytm1 обнаруживается в различных ориентациях, подчеркивая гибкую ориентацию этого домена по отношению к домену β-пропеллера (45).Учитывая структурное сходство домена UBL Ytm1 / WDR12, представленного здесь, и Rsa4 / Nle1 ( A ), включая перекрывающиеся остатки глутамата, взаимодействия между доменом MIDAS мидазина и доменами UBL WDR12 и Nle1 должны быть очень похожими. Это напоминает интегрины, которые могут взаимодействовать с рядом различных лигандов через свои домены MIDAS (46).

В то время как WDR12 и Nle1 хорошо законсервированы, мало что известно об их роли в биогенезе рибосом млекопитающих.В этом исследовании мы представляем первые доказательства того, что взаимодействия с мидазином и WDR12, а также с мидазином и Nle1 законсервированы у высших организмов. Как и в дрожжах, домен UBL WDR12 необходим для связывания мидазина, но не для образования комплекса PeBoW вместе с Pes1 и Bop1 ( C ). UBL-домен Nle1 также необходим для связывания мидазина ( D ). Эти результаты подтверждают, что высвобождение ядрышкового комплекса PeBoW и нуклеоплазматического Nle1 с помощью большого моторного белка, midasin, является хорошо законсервированной стадией в пути созревания эукариотических рибосом.

Роль WDR12 и мидазина в биогенезе рибосом млекопитающих также подтверждается их эндогенной локализацией. WDR12 демонстрирует заметную локализацию ядрышка; однако клеточный стресс, вызванный обработкой клеток актиномицином D, останавливает транскрипцию рРНК и приводит к перемещению WDR12 в нуклеоплазму (2). Мидазин человека не обнаруживал ядрышковой локализации, а скорее обнаруживался в нуклеоплазме и цитоплазме как в нормальных, так и в стрессовых условиях (). Локализация человеческого мидазина аналогична локализации его дрожжевого гомолога, который не обнаруживается в ядрышке, за исключением присутствия глутаматного мутанта E80A Ytm1, который останавливает созревание рибосом (21).Как мидазин рекрутируется на прерибосомные частицы в ядрышке, пока неизвестно. Предыдущая работа предположила, что WDR12 и комплекс Rix являются двумя наиболее вероятными кандидатами для рекрутирования, хотя могут быть задействованы и другие транс-действующие факторы (21). В совокупности эти результаты подтверждают, что мидазин только временно связан с ядрышком, чтобы управлять высвобождением комплекса PeBoW.

Мы также определили, что область удлинения MIDAS в мидазине млекопитающих необходима для связывания WDR12 и Nle1 ().Область удлинения не является частью канонического домена MIDAS, но является высококонсервативной и важной для связывания WDR12 и Nle1, предполагая, что она также может играть важную роль в координации ионов металлов. Функции интегринов зависят от ионов металлов, и их зависимость от ионов металлов хорошо изучена (38). Некоторые интегриновые домены содержат сайты связывания ионов металлов в дополнение к домену MIDAS. Например, домен интегрина βI состоит из трех взаимосвязанных сайтов связывания ионов металлов, включая сайт MIDAS, примыкающий к сайту MIDAS (AMIDAS), и синергетический сайт связывания ионов металла (SyMBS).Точное значение in vivo и ролей всех трех сайтов неясно, но in vitro , все три сайта, по-видимому, играют важную роль в опосредовании связывания лиганда (38). Нет никакого сходства последовательностей между областью удлинения MIDAS и сайтами связывания ионов металлов SyMBS или AMIDAS, но область удлинения MIDAS может представлять новый тип координационного сайта иона металла. Биоинформатический анализ показал, что существует слабое сходство между областью удлинения MIDAS и субъединицей D хелатаз магния, основанное на высокой плотности основных и гидрофобных остатков непосредственно перед доменом MIDAS (23).Хелатазы магния, которые играют важную роль в биосинтезе хлорофилла, вставляя Mg 2+ в протопорфирин, также содержат C-концевые домены MIDAS и два N-концевых домена AAA (47). Помимо хелатаз магния и мидазина, существует только один известный белок, VWA8 (обнаружен только у высших организмов; функция неизвестна), который содержит комбинацию доменов AAA и MIDAS (37). Дальнейшая работа будет необходима для определения точной роли области удлинения MIDAS в midasin, но будет интересно посмотреть, существует ли функциональная связь между доменами AAA и доменом MIDAS, потому что эта комбинация также встречается в двух др. Белках.

В этой статье мы представляем первую структуру с высоким разрешением UBL домена дрожжевого гомолога Ytm1 / WDR12 и демонстрируем, что мидазин млекопитающих связывается как с WDR12, так и с Nle1, двумя белками, которые имеют интересные последствия для здоровья человека. Недавняя работа продемонстрировала, что сверхэкспрессия WDR12 вызвана сердечной перегрузкой, а исследования ассоциации генома связывают ген WDR12 с ранним началом инфаркта миокарда и ишемической болезни сердца (20, 48).Также было показано, что повышающая регуляция WDR12 приводит к активации пути p38 MAPK, увеличению уровней Bop1 и, в конечном итоге, к дисфункции миокарда, что позволяет предположить, что WDR12 может быть новой терапевтической мишенью для пациентов с сердечной недостаточностью (20). Более того, повышенные уровни белков, связанных с комплексом PeBoW, были обнаружены при многих различных типах рака человека, включая нейробластому, гепатоцеллюлярную карциному и рак груди, толстой кишки и яичников (42, 49, –55). Nle1 также недавно было показано, как критический фактор для гомеостаза кишечника и потребность в органогенезе, особенно в формировании осевого скелета у мышей (13, 56).Дальнейшие исследования роли WDR12 и Nle1 необходимы для определения механизмов, с помощью которых они участвуют в сердечной функции и гомеостазе кишечника, но наша работа показывает, что взаимодействия между доменами UBL WDR12 и Nle1 с мидазином являются важными эволюционно законсервированными взаимодействиями. для синтеза эукариотических рибосом.

Вклад авторов

E. M. R. очистил и кристаллизовал UBL-домен Ytm1 и определил его структуру.E. M. R. спроектировал и сконструировал векторы для «pull-down» и охарактеризовал сложное взаимодействие в клетках млекопитающих. M.S. провел эксперименты по иммунофлуоресценции и весь вестерн-блот-анализ. Р. Э. С. разработал исследование и задумал эксперименты. E. M. R., M. S. и R. E. S. проанализировали данные, подготовили цифры и написали статью.

Благодарности

Мы благодарим Трэйси М. Танака Холл и Майкла Дж. Рагуза за критическое прочтение рукописи. Мы также благодарим NIEHS, Национальные институты здравоохранения, Protein Expression Core за помощь с культурой клеток млекопитающих и ядро ​​рентгеновской кристаллографии NIEHS за помощь в сборе данных.Дифракционные данные были собраны Юго-восточной региональной группой совместного доступа (SER-CAT) 22-ID и 22-BM пучков пучков в усовершенствованном источнике фотонов, Аргоннская национальная лаборатория. Мы также благодарим Центр флуоресцентной микроскопии и визуализации NIEHS за помощь в проведении иммунофлуоресцентных экспериментов.

* Эта работа была полностью или частично поддержана Программой внутренних исследований NIEHS, Национальных институтов здравоохранения. Использование усовершенствованного источника фотонов было поддержано Министерством энергетики США, Управлением науки, Управлением фундаментальных энергетических наук по контракту W-31-109-Eng-38.Авторы заявляют, что у них нет конфликта интересов по поводу содержания этой статьи. Авторы несут полную ответственность за содержание, которое не обязательно отражает официальную точку зрения Национальных институтов здравоохранения.

Координаты атомов и структурные факторы (код 5DTC) депонированы в банке данных белков (http://wwpdb.org/).

2 Используемые сокращения:

рРНК
рибосомальная РНК
MIDAS
металл-ион-зависимый сайт адгезии
AMIDAS
рядом с MIDAS
SyMBS
синергетический сайт связывания с ионами металла
молекула межклеточной адгезии.

Список литературы

1. Дженнер Л., Мельников С., Гарро де Лубресс Н., Бен-Шем А., Искакова М., Уржумцев А., Мескаускас А., Динман Дж., Юсупова Г., Юсупов М. . (2012) Кристаллическая структура рибосомы 80S дрожжей. Curr. Opin. Struct. Биол. 22, 759–767 [PubMed] [Google Scholar] 3. Томсон Э., Феррейра-Черка С. и Херт Э. (2013) Биогенез эукариотических рибосом с первого взгляда. J. Cell Sci. 126, 4815–4821 [PubMed] [Google Scholar] 5. Кресслер Д., Хёрт Э. и Басслер Дж. (2010) Привод сборки рибосом.Биохим. Биофиз. Acta 1803, 673–683 [PubMed] [Google Scholar] 6. Tafforeau L., Zorbas C., Langhendries J. L., Mullineux S. T., Stamatopoulou V., Mullier R., Wacheul L. и Lafontaine D. L. (2013) Сложность биогенеза рибосом человека, выявленная систематическим ядрышковым скринингом факторов процессинга пре-рРНК. Мол. Клетка 51, 539–551 [PubMed] [Google Scholar] 8. Вудс С. Дж., Ханнан К. М., Пирсон Р. Б. и Ханнан Р. Д. (2015) Ядрышко как фундаментальный регулятор ответа р53 и новая мишень для терапии рака.Биохим. Биофиз. Acta 1849, 821–829 [PubMed] [Google Scholar] 9. Бурсак С., Брдовчак М.С., Донати Г. и Воларевич С. (2014) Активация опухолевого супрессора p53 при нарушении биогенеза рибосом. Биохим. Биофиз. Acta 1842, 817–830 [PubMed] [Google Scholar] 10. Голомб Л., Воларевич С. и Орен М. (2014) p53 и стресс биогенеза рибосом: главное. FEBS Lett. 588, 2571–2579 [PubMed] [Google Scholar] 12. Куин Дж. Э., Девлин Дж. Р., Кэмерон Д., Ханнан К. М., Пирсон Р. Б. и Ханнан Р.D. (2014) Нацеливание на ядрышко для лечения рака. Биохим. Биофиз. Acta 1842, 802–816 [PubMed] [Google Scholar] 13. Стедман А., Бек-Кормье С., Ле Бутейлер М., Раво А., Вандормаэль-Пурнин С., Кокеран С., Лежур В., Джарзебовски Л., Толедо Ф., Робин С. и Коэн-Таннуджи М. . (2015) Дисфункция биогенеза рибосом приводит к p53-опосредованному апоптозу и дифференцировке бокаловидных клеток кишечных стволовых клеток / клеток-предшественников мышей. Смерть клетки отличается. 22, 1865–1876 [Бесплатная статья PMC] [PubMed] [Google Scholar] 14.Mullineux S. T. и Lafontaine D. L. (2012). Картирование сайтов расщепления на пре-рРНК млекопитающих: где мы находимся? Биохимия 94, 1521–1532 [PubMed] [Google Scholar] 15. Hölzel M., Rohrmoser M., Schlee M., Grimm T., Harasim T., Malamoussi A., Gruber-Eber A., ​​Kremmer E., Hiddemann W., Bornkamm GW, and Eick D. (2005) Mammalian WDR12 является новым членом комплекса Pes1-Bop1 и необходим для биогенеза рибосом и пролиферации клеток. J. Cell Biol. 170, 367–378 [Бесплатная статья PMC] [PubMed] [Google Scholar] 16.Rohrmoser M., Hölzel M., Grimm T., Malamoussi A., Harasim T., Orban M., Pfisterer I., Gruber-Eber A., ​​Kremmer E., and Eick D. (2007) Взаимозависимость Pes1, Bop1 и WDR12 контролирует локализацию ядрышек и сборку комплекса PeBoW, необходимого для созревания 60S субъединицы рибосомы. Мол. Клетка. Биол. 27, 3682–3694 [Бесплатная статья PMC] [PubMed] [Google Scholar] 17. Miles T. D., Jakovljevic J., Horsey E. W., Harnpicharnchai P., Tang L. и Woolford J. L. Jr. (2005) Ytm1, Nop7 и Erb1 образуют комплекс, необходимый для созревания прерибосом 66S дрожжей.Мол. Клетка. Биол. 25, 10419–10432 [Бесплатная статья PMC] [PubMed] [Google Scholar] 18. Tang L., Sahasranaman A., Jakovljevic J., Schleifman E., and Woolford J. L. Jr. (2008) Взаимодействия между Ytm1, Erb1 и Nop7, необходимые для сборки подкомплекса Nop7 в прерибосомах дрожжей. Мол. Биол. Клетка 19, 2844–2856 [Бесплатная статья PMC] [PubMed] [Google Scholar] 19. Du Y. C. и Stillman B. (2002) Yph2p, ORC-взаимодействующий белок: потенциальные связи между контролем пролиферации клеток, репликацией ДНК и биогенезом рибосом.Клетка 109, 835–848 [PubMed] [Google Scholar] 20. Мойланен AM, Rysä J., Kaikkonen L., Karvonen T., Mustonen E., Serpi R., Szabó Z., Tenhunen O., Bagyura Z., Näpänkangas J., Ohukainen P., Tavi P., Kerkelä R. , Leósdóttir M., Wahlstrand B., Hedner T., Melander O., and Ruskoaho H. (2015) WDR12, член ядрышкового комплекса PeBoW, активируется при сердечной недостаточности и вызывает ухудшение сердечной функции. PLoS One 10, e0124907. [Бесплатная статья PMC] [PubMed] [Google Scholar] 21. Басслер Дж., Каллас М., Pertschy B., Ulbrich C., Thoms M., and Hurt E. (2010) AAA-ATPase Rea1 управляет удалением факторов биогенеза во время нескольких стадий сборки 60S рибосомы. Мол. Клетка 38, 712–721 [Бесплатная статья PMC] [PubMed] [Google Scholar] 22. Кресслер Д., Хёрт Э., Берглер Х. и Басслер Дж. (2012) Сила ААА-АТФаз на пути созревания рибосом до 60S: молекулярные машины, которые удаляют прерибосомные частицы. Биохим. Биофиз. Acta 1823, 92–100 [Бесплатная статья PMC] [PubMed] [Google Scholar] 23. Гарбарино Дж.Е. и Гиббонс И. Р. (2002) Экспрессия и геномный анализ мидазина, нового и высококонсервативного белка ААА, отдаленно родственного динеину. BMC Genomics 3, 18. [Бесплатная статья PMC] [PubMed] [Google Scholar] 24. Ulbrich C., Diepholz M., Bassler J., Kressler D., Pertschy B., Galani K., Böttcher B., and Hurt E. (2009) Механохимическое удаление факторов биогенеза рибосом из формирующихся рибосомных субъединиц 60S. Клетка 138, 911–922 [PubMed] [Google Scholar] 25. Royet J., Bouwmeester T. и Cohen S. M. (1998) Notchless кодирует новый белок, содержащий повтор WD40, который модулирует активность передачи сигналов Notch.EMBO J. 17, 7351–7360 [Бесплатная статья PMC] [PubMed] [Google Scholar] 26. Nal B., Mohr E., Silva MI, Tagett R., Navarro C., Carroll P., Depetris D., Verthuy C., Jordan BR и Ferrier P. (2002) Wdr12, мышиный ген, кодирующий новый WD. -повторный белок с беззубчатым аминоконцевым доменом. Геномика 79, 77–86 [PubMed] [Google Scholar] 27. Шеффилд П., Гаррард С. и Деревенда З. (1999) Преодоление проблем экспрессии и очистки RhoGDI с использованием семейства «параллельных» векторов экспрессии.Protein Expr. Purif. 15, 34–39 [PubMed] [Google Scholar] 28. Adams PD, Afonine PV, Bunkóczi G., Chen VB, Davis I.W, Echols N., Headd JJ, Hung LW, Kapral GJ, Grosse-Kunstleve RW, McCoy AJ, Moriarty NW, Oeffner R., Read RJ, Richardson DC, Ричардсон Дж. С., Тервиллигер Т. С. и Цварт PH (2010) PHENIX: комплексная система на основе Python для решения макромолекулярных структур. Acta Crystallogr. D Biol. Кристаллогр. 66, 213–221 [Бесплатная статья PMC] [PubMed] [Google Scholar] 29.Винн М.Д., Баллард С.К., Каутан К.Д., Додсон Э.Д., Эмсли П., Эванс П.Р., Киган Р.М., Криссинель Э.Б., Лесли А.Г., Маккой А., МакНиколас С.Дж., Муршудов Г.Н., Панну Н.С., Поттертон Е.А., Пауэлл Х.Р., Рид Р.Дж., Вагин А., Уилсон К.С. (2011) Обзор пакета CCP4 и текущих разработок. Acta Crystallogr. D Biol. Кристаллогр. 67, 235–242 [Бесплатная статья PMC] [PubMed] [Google Scholar] 30. Гитц Р. Д. и Сугино А. (1988) Новые шаттл-векторы дрожжей Escherichia coli , сконструированные с in vitro мутагенизированными генами дрожжей, лишенными сайтов рестрикции из шести пар оснований.Ген 74, 527–534 [PubMed] [Google Scholar] 31. Ариску А. Р., Лу В., и Джонс Э. Ю. (2006) Экономичная по времени и затратам система для производства белка на высоком уровне в клетках млекопитающих. Acta Crystallogr. D Biol. Кристаллогр. 62, 1243–1250 [PubMed] [Google Scholar] 32. Морита Э., Сандрин В., Алам С. Л., Экерт Д. М., Гайги С. П. и Сандквист В. И. (2007) Идентификация белков MVB12 человека как субъединиц ESCRT-I, которые функционируют в почковании ВИЧ. Клеточный микроб-хозяин 2, 41–53 [Бесплатная статья PMC] [PubMed] [Google Scholar] 33.Басслер Дж., Патернога Х., Гёльдерманн И., Томс М., Граннеман С., Баррио-Гарсия К., Ньярко А., Стир Г., Кларк С.А., Шрайвогель Д., Каллас М., Бекманн Р., Толлервей D., Barbar E., Sinning I., and Hurt E. (2014) Сеть сборочных факторов участвует в ремоделировании элементов рРНК во время созревания прерибосом. J. Cell Biol. 207, 481–498 [Бесплатная статья PMC] [PubMed] [Google Scholar] 35. Galani K., Nissan T. A., Petfalski E., Tollervey D., and Hurt E. (2004) Rea1, связанная с динеином ядерная ААА-АТФаза, участвует в позднем процессинге рРНК и ядерном экспорте 60 S субъединиц.J. Biol. Chem. 279, 55411–55418 [PubMed] [Google Scholar] 36. Chantha S. C. и Matton D. P. (2007) Недостаточная экспрессия гена NOTCHLESS растения, кодирующего белок WD-повтора, вызывает плейтропный фенотип во время развития растения. Planta 225, 1107–1120 [PubMed] [Google Scholar] 37. Whittaker C.A., и Hynes R.O. (2002) Распределение и эволюция доменов фон Виллебранда / интегрина A: широко рассредоточенные домены, играющие роль в клеточной адгезии и в других местах. Мол. Биол. Клетка 13, 3369–3387 [Бесплатная статья PMC] [PubMed] [Google Scholar] 39.Сонг Г., Янг Ю., Лю Дж. Х., Казасновас Дж. М., Шимаока М., Спрингер Т. А. и Ван Дж. Х. (2005) Атомное разрешение распознавания ICAM в комплексе между связывающими доменами ICAM-3 и интегрином αLβ2. Proc. Natl. Акад. Sci. U.S.A. 102, 3366–3371 [Бесплатная статья PMC] [PubMed] [Google Scholar] 40. Эрнандес-Верден Д., Руссель П., Тири М., Сирри В. и Лафонтен Д. Л. (2010) Ядрышко: взаимосвязь между структурой и функцией в метаболизме РНК. Wiley Interdiscip. Rev. РНК 1, 415–431 [PubMed] [Google Scholar] 41.Castle C.D., Cassimere E.K. и Denicourt C. (2012) LAS1L взаимодействует с комплексом Rix1 млекопитающих, чтобы регулировать биогенез рибосом. Мол. Биол. Клетка 23, 716–728 [Бесплатная статья PMC] [PubMed] [Google Scholar] 42. Zhang J., Yang Y., and Wu J. (2009) B23 взаимодействует с PES1 и участвует в ядрышковой локализации PES1. Acta Biochim. Биофиз. Грех. 41, 991–997 [PubMed] [Google Scholar] 43. Grabbe C. и Dikic I. (2009) Функциональные роли белков, содержащих убиквитин-подобный домен (ULD) и убиквитин-связывающий домен (UBD).Chem. Ред. 109, 1481–1494 [PubMed] [Google Scholar] 44. Су В. и Лау А. Ф. (2009) Убиквитин-подобные и убиквитин-ассоциированные доменные белки: значение в протеасомной деградации. Cell Mol. Life Sci. 66, 2819–2833 [Бесплатная статья PMC] [PubMed] [Google Scholar] 45. Wegrecki M., Rodriguez-Galan O., de la Cruz J., and Bravo J. (2015) Структура комплекса Erb1-Ytm1 показывает функциональную важность высокоаффинного связывания между двумя β-пропеллерами во время сборки больших рибосомные субъединицы у эукариот.Nucleic Acids Res., 10.1093 / nar / gkv1043 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 47. Adams N. B., and Reid J. D. (2013) Аллостерическая роль AAA + домена белка ChlD из хелатазы магния синехоцистных видов PCC 6803. J. Biol. Chem. 288, 28727–28732 [Бесплатная статья PMC] [PubMed] [Google Scholar] 48. Забалза М., Субирана И., Луис-Ганелла К., Сайолс-Байксерас С., де Гроот Э., Арнольд Р., Сенарро А., Рамос Р., Марругат Дж. И Элосуа Р. (2015) Ассоциация между Генетические варианты ишемической болезни сердца и субклинический атеросклероз: исследование ассоциации и метаанализ.Rev. Esp. Кардиол. 68, 869–877 [PubMed] [Google Scholar] 49. Killian A., Sarafan-Vasseur N., Sesboüé R., Le Pessot F., Blanchard F., Lamy A., Laurent M., Flaman JM и Frébourg T. (2006) Вклад гена BOP1, локализованного на 8q24 , к колоректальному онкогенезу. Гены Хромосомы Рак 45, 874–881 [PubMed] [Google Scholar] 50. Chung K. Y., Cheng I. K., Ching A. K., Chu J. H., Lai P. B., and Wong N. (2011) Блок пролиферации 1 (BOP1) играет онкогенную роль в гепатоцеллюлярной карциноме, способствуя переходу эпителия в мезенхиму.Гепатология 54, 307–318 [PubMed] [Google Scholar] 51. Cheng L., Li J., Han Y., Lin J., Niu C., Zhou Z., Yuan B., Huang K., Li J., Jiang K., Zhang H., Ding L., Xu X ., and Ye Q. (2012) PES1 способствует развитию рака молочной железы, по-разному регулируя ERα и ERβ. J. Clin. Вкладывать деньги. 122, 2857–2870 [Бесплатная статья PMC] [PubMed] [Google Scholar] 52. Xie W., Feng Q., Su Y., Dong B., Wu J., Meng L., Qu L., and Shou C. (2012) Транскрипционная регуляция экспрессии PES1 с помощью c-Jun при раке толстой кишки. PLoS One 7, e42253. [Бесплатная статья PMC] [PubMed] [Google Scholar] 53.Li J., Zhuang Q., Lan X., Zeng G., Jiang X. и Huang Z. (2013) PES1 по-разному регулирует экспрессию ERα и ERβ при раке яичников. IUBMB Life 65, 1017–1025 [PubMed] [Google Scholar] 54. Xie W., Qu L., Meng L., Liu C., Wu J., and Shou C. (2013) PES1 регулирует чувствительность клеток колоректального рака к противоопухолевым препаратам. Biochem. Биофиз. Res. Commun. 431, 460–465 [PubMed] [Google Scholar] 55. Накагуро М., Киёнари С., Кишида С., Цао Д., Мураками-Тонами Ю., Итикава Х., Такеучи И., Накамура С., и Kadomatsu K. (2015) Ядерный белок PES1 является маркером исхода нейробластомы и связан с дифференцировкой нейробластомы. Cancer Sci. 106, 237–243 [Бесплатная статья PMC] [PubMed] [Google Scholar] 56. Beck-Cormier S., Escande M., Souilhol C., Vandormael-Pournin S., Sourice S., Pilet P., Babinet C., and Cohen-Tannoudji M. (2014) Notchless требуется для формирования осевого скелета у мышей. . PLoS One 9, e98507. [Бесплатная статья PMC] [PubMed] [Google Scholar]

(PDF) Тандемная аффинная очистка белков, конъюгированных с убиквитиноподобными фрагментами

p

uo

r

G

gn

i

h

s

i

фунтов

uP eru

t

a

N

010

2

© natureprotocols

/

m

e

r

u

t

a

n

.

w

w

w

/

/

:

pt

t

h

ПРОТОКОЛ

ПРИРОДА ПРОТОКОЛОВ | ТОМ 5 №5 | 2010 | 877

показывает, что с точки зрения общей численности (а не количества отдельных белков

), примеси составляют лишь около 15% от общего количества очищенного образца

.

Выбор культур клеток. Те, кто интересуется протеомом субстрата

Ubl, могут просто следовать протоколу, описанному здесь

, для ~ 100-200 чашек для культивирования клеток диаметром 15 см для своих клеток

TAP-Ubl и анализировать результаты с помощью МС. Однако, поскольку

не каждый идентифицированный белок будет истинным субстратом, это создает

проблему фильтрации реальных целевых белков от «очищенных примесей».Для сравнительного количественного анализа белков

доступен ряд методов, включая iTRAQ (Applied

Biosystems, Foster City, CA, USA) и методы без меток3 9,

, но это метод метаболического мечения, известный как SILAC ( см.

Вставка 2), который чаще всего используется в поле Ubl. Путем количественного сравнения набора контрольных данных, такого как очистка только TAP,

с тестовым набором (TAP-Ubl), можно сделать обоснованное суждение

о том, какой из сотен идентифицированных белков наиболее вероятен. до

могут быть конъюгатами Ubl на основании разницы в содержании конкретных белков

(см. Golebiowski et al.15 для примера) 30.

Мониторинг очистки. Может быть информативным сбор небольших

образцов элюентов и смол на разных этапах очистки,

, например, на этапах 7, 12, 14, 18, 20, 29 и 39. Это позволяет оценить эффективность

конкретные шаги с помощью окрашивания серебром или вестерн-блоттинга.

Сроки. Для получения образца очищенного белка, готового к анализу

из культивируемых клеток, требуется около 5–6 дней.Однако обычно требуется 6–8 дней для культивирования клеток перед экстракцией и очисткой белка и

фиксации, и 1-2 дня для экстракции пептидов из полиакриламидных гелей, готовых

для анализа МС. Помимо сбора данных МС, последующая обработка

может занять гораздо больше времени, чем подготовка образца (см. Вставку 1).

МАТЕРИАЛЫ

РЕАГЕНТЫ

Материалы, относящиеся к культуре клеток:

Клетки HeLa / TAP, HeLa / TAP-SUMO-2 или -1 (лаборатория RT Hay)

Среда Игла, модифицированная Дульбекко (Gibco, cat.нет. 61965)

Трипсин ЭДТА (Gibco, каталожный номер 25300)

Фетальная бычья сыворотка (Biosera, каталожный номер S1830-500)

Антибиотики по желанию (например, пенициллин и стрептомицин)

Для материалов, относящихся к SILAC культура клеток и маркировка см. ссылки 15,30,32

и вставку 2.

IAA (Sigma, каталожный номер I-6125)! ВНИМАНИЕ! ИУК токсичен; следовательно, избегайте прямого воздействия

.

β-меркаптоэтанол (Sigma, каталожный номер M-7154)! ВНИМАНИЕ! Β-меркаптоэтанол

токсичен; следовательно, избегайте прямого воздействия.

NP-40 (Calbiochem, каталожный номер 4)

SDS (Мелфорд, каталожный номер B2008)

Имидазол (Sigma, каталожный номер I-0125)

ЭДТА (Sigma, каталожный номер. E-5134)

EGTA (Fluka, каталожный номер 03777)

Трис-основание (Sigma, каталожный номер T-6066)

Полный ингибитор протеазы без ЭДТА (Roche, каталожный номер 11873580001)

Глицерин (BDH, кат. № 101186M)

Бромфеноловый синий (BDH, кат. № 443053A)

DTT (Formedium, кат. № DTT010)

Хлорид натрия (Sigma, кат.нет. S-7653)

Ацетат магния (Sigma, кат. № M-2545)

Хлорид кальция (Fisher Scienti ‑ fc, кат. № C / 1500/53)

Гидроксид натрия (VWR, кат. № 28244.295)

TCA (BDH, номер по каталогу 304894L)

Дезоксихолат (DOC; Calbiochem, номер по каталогу 264101)

Буфер для образца LDS (4 ×; Invitrogen, номер по каталогу B31010)

Восстановитель для образца LDS буфер (10 ×; Invitrogen, кат. номер NP0004)

Coomassie R-250 (BDH, кат. номер 443283M)

Буфер MOPS (Invitrogen, кат.нет. NP001)

IgG – сефароза 6 Fast Flow (GE Healthcare, кат. № 17-0969-01)

Кальмодулин – сефароза 4B (GE Healthcare, кат. № 17-0529-01)

TEV протеаза (~ 1 Ед / мкл; производится на месте; определение единицы / активность

установлено по сравнению с протеазой ProTEV, Promega, каталожный номер

V6051 – см. Описание производителя для подробностей)

ОБОРУДОВАНИЕ

Пипетка с плоским концом наконечники (Starlab, кат. № I1022-2600)

Наконечники с плоским концом сводят к минимуму потерю шариков на этапах аспирации надосадочной жидкости.

Скребки для клеток (TPP, кат. № 99003)

Настольная центрифуга (Heraeus Biofuge — Thermo Scienti c)

Сверхскоростная центрифуга (Beckman-Coulter, Avanti J-25 и ротор типа 70 Ti)

Жидкость Установка аспиратора (вакуумный газовый насос; VWR, кат. № PM 20405-86)

Пластиковые пробирки «Falcon» (15 и 50 мл; Greiner, кат. № 188271 и

210261, соответственно)

0002 •

000

000

000

0002 •

000

000

0002 •

000

000 •

000 •

000 •

000 •

000 •

000 •

000

• 900 03

Пробирки с завинчивающейся крышкой (1.5 мл; Alphalabs, кат. нет. CP5515)

пробирки «Lo-Bind» (1,5 мл; Eppendorf, каталожный номер 022431081).  КРИТИЧНО Очень важно использовать пробирки с низкой способностью связывания с белками, чтобы избежать загрязнения образцов для конечной элюции белками

в промывочных буферах.

Соникатор с датчиком, подходящим для проб объемом ~ 30 мл (Branson digital

sonifer 450; Branson)

Гели и оборудование для PAGE.  КРИТИЧЕСКИЕ Могут использоваться в соответствии с предпочтениями пользователя

, но с использованием 10% (вес / объем) готовых гелей, таких как Invitrogen, кат.

нет. NP0301, предлагаются; в случае установки электрофореза от другого производителя

, следует использовать соответствующие рабочие буферы и буферы для образцов

вместо тех, которые указаны в этом протоколе.

Пластиковые одноразовые шприцы 5 и 10 мл

Иглы (~ 19 G)

Одноразовые фильтрующие блоки Minisart (0,2 и 0,45 мкм; Sartorius Stedim Biotech,

каталожные номера 16534 и 16555 соответственно)

Разное предметы, необходимые для установки системы очистки гравитационным потоком,

, такие как пластиковые одноразовые колонки, пробирки, краны, бутылки, штатив и т. д.Альтернативно

можно использовать собственную систему с помпой, такую ​​как быстрая жидкостная хроматография белков

, но мы считаем, что гравитационная система

собственной сборки является наиболее безопасным вариантом.

Гематологический роликовый миксер Stuart SRT-9 (Stuart Scienti)

Стерильные скальпели

НАБОР РЕАГЕНТОВ

Векторы pEFIRES-P, экспрессирующие TAP, TAP-SUMO-1 и TAP-SUMO-2

клетки со стабильной экспрессией белков HeLa этих белков и ограничений

карт доступны у нас по запросу.Для получения подробной информации о векторе pEFIRES-P

см. Рисунок 1a, b и Hobbs et al. 38.

Буфер для лизиса 50 мМ трис-HCl pH 8,0, 2% (вес / объем) SDS, 10 мМ IAA, 1 мМ

EDTA, полный ингибитор протеазы Roche (без EDTA). Приготовьте 150 мл путем смешивания

следующего: 7,5 мл 1 M трис / HCl pH 8,0, 15 мл 20% (вес / объем) SDS,

7,5 мл 200 мМ IAA, 300 мкл 500 мМ EDTA pH 8,0, Roche Complete Protease

Таблетки ингибитора, рекомендованные производителем (обычно три большие таблетки по

150 мл), вода до 150 мл.Хранить (без ингибиторов протеазы ИУК и Рош)

до месяца при комнатной температуре (КТ).  КРИТИЧЕСКАЯ ИУК для всех баффов

лучше всего готовить в виде 200 мМ раствора в воде и хранить при -20 ° C

в защищенном от света месте. Добавьте IAA и полный ингибитор протеазы непосредственно перед использованием

и храните при комнатной температуре. ! ВНИМАНИЕ! ИУК токсичен; избежать контакта.

Базовый буфер TAP (TBB) Состав 2 × раствора: 100 мМ Трис pH 8,0,

1.5 М NaCl. Этот буфер служит основным буфером для создания других буферов: буфер ренатурации

, буфер TEV, буфер для элюции кальмодулина и буфер связывания кальмодулина

. Приготовьте 2,3 л, смешав следующее: 230 мл 1 M Tris pH 8,0,

202 г NaCl, вода до 2,3 л. Хранить до месяца при 4 ° C.

Буфер для ренатурации (RB) 50 мМ Трис-HCl pH 8,0, 0,75 М NaCl, 1% NP-40,

2 мМ ИУК, 0,5 мМ ЭДТА. Приготовьте 4 мкл, смешав следующее: 2 мкл буфера TAP base

, 40 мл 100% NP-40, 40 мл, 200 мМ IAA, 4 мл 0.5 M EDTA, вода

до 4 л.  ВАЖНО Приготовить свежий и хранить при 4 ° C до тех пор, пока он не понадобится.

Характеристика протеазной активности Nsp3 при ингибировании SARS-CoVro-2 и его in vitro нанотела

Введение

COVID-19 нанес значительный урон человеческим жизням и беспрецедентным образом повлиял на общество.Следовательно, понимание механизмов, с помощью которых SARS-CoV-2 взаимодействует с клетками человека, и функций различных вирусных белков в установлении инфекции имеет первостепенное значение. Геном SARS-CoV-2 кодирует 16 неструктурных белков (Nsps), которые играют разные роли в жизненном цикле вируса (Wu et al , 2020). Nsp3, самый большой из Nsps, представляет собой мультидоменный мембранный белок 217 кДа, который является ключевым компонентом комплекса репликации и транскрипции вируса, собранного на мембранах клетки-хозяина, где происходит репликация и транскрипция вирусного генома (Angelini et al , 2013; Wolff et al , 2020a, 2020b).Другой важной ролью Nsp3 является его функция протеазы. Внутри Nsp3 кодируется папаин-подобная протеаза (PLpro CoV-2 ), которая расщепляет Nsp1-Nsp2, Nsp2-Nsp3 и Nsp3-Nsp4, высвобождая Nsp1, Nsp2 и Nsp3 из вирусного полипептида. В то время как несколько коронавирусов экспрессируют два фермента PLpro, SARS-CoV-2 экспрессирует только один фермент PLpro (Barretto et al , 2005).

PLpro CoV-2 имеет много общего с PLpro, закодированным с помощью SARS, PLpro SARS .Структура PLpro аналогична структуре деубиквитинирующих ферментов (DUB) человеческой убиквитинспецифической протеазы (USP), которые напоминают вытянутую или открытую руку с субдоменами большого пальца, ладони и пальцев, которые опосредуют контакты с субстратом с образованием сайта S1 (Shin et al. al , 2020; Klemm et al , 2020; Ratia et al , 2014; Chou et al , 2014). Помимо процессинга вирусных полипептидов, PLpro обладает деубиквитилирующей и деISGилирующей активностями, так как он также может эффективно расщеплять убиквитин и модификации ISG15 (Bailey-Elkin et al , 2017).Убиквитилирование и ISGylation, ковалентное присоединение убиквитина и убиквитин-подобного модификатора (Ubl) ISG15 соответственно к белкам, являются важными посттрансляционными модификациями (PTM) в антивирусных и воспалительных сигнальных путях врожденного иммунитета хозяина (Swatek & Komander, 2016). ISG15 – это стимулируемый интерфероном ген, экспрессия которого индуцируется после вирусной инфекции и важна для противовирусного ответа (Perng & Lenschow, 2018). PLpro SARS обладает уникальным механизмом действия, поскольку он распознает убиквитин в дополнительном сайте связывания убиквитина S2, чтобы связывать и отщеплять связанные с K48 цепи убиквитина от субстратов (Békés et al , 2015, 2016).ISG15 содержит два связанных домена Ubl, которые вместе напоминают диубиквитин, который может связываться с сайтами S1 и S2. Эти дополнительные протеазные активности PLpro противодействуют убиквитилированию и ISGилированию хозяина, эффективно подавляя противовирусную передачу сигналов и иммунный ответ хозяина. Эти многогранные роли PLpro делают его важным для репликации вируса, что делает его привлекательной терапевтической мишенью для COVID-19.

Учитывая большой размер Nsp3, PLpro и другие домены в Nsp3 были индивидуально охарактеризованы в деталях.Однако в большинстве исследований изучали только минимальный протеолитический домен PLpro, и мало что известно о влиянии других доменов в Nsp3 на активность и функцию протеазы. В настоящем исследовании мы проводим подробную биохимическую характеристику минимального PLpro CoV-2 и сравниваем его с протеазной активностью Nsp3 CoV-2 . Мы сделали неожиданное наблюдение, что удлиненный Nsp3 является более активной протеазой, с большей эффективностью расщепляющей как ISG15, так и K48-связанные цепи.Интересно, что хотя Nsp3 может очень эффективно расщеплять вирусный полипептид Nsp1-Nsp2, минимальный PLpro не может расщеплять этот гибрид. Чтобы найти ингибиторы PLpro, мы использовали высокопроизводительный анализ на основе MALDI TOF для скрининга соединений, одобренных FDA 1971 года, и выявления ингибиторов протеазы со значениями IC 50 в диапазоне 1-10 мкМ. Несмотря на проявление хорошего ингибирования in vitro , ни один из ингибиторов не проявляет никакой эффективности в блокировании репликации вируса на модели вирусной инфекции SARS-CoV-2.Поэтому мы разработали нанотела, которые связываются с PLpro и ингибируют его в наномолярном диапазоне. Эти нанотела будут ценными инструментами для идентификации клеточных субстратов Nsp3 и исследования биологии Nsp3.

Результаты и обсуждение

Характеристика протеазной активности PLpro и Nsp3

PLpro представляет собой многофункциональный фермент с тремя различными протеазными активностями, которые катализируют расщепление (i) полиубиквитина, связанного с K48, (ii) ISG15 и (iii) вирусных полипептидов . Чтобы понять, как PLpro может расщеплять эти структурно отличные субстраты, и дополнительно охарактеризовать эти три активности, мы сначала создали соответствующие субстраты.Как ранее наблюдалось для PLpro SARS , PLpro CoV-2 также является селективным при расщеплении цепей, связанных с K48 ( рис. 1B, S1A ), и демонстрирует аналогичный способ расщепления путем расщепления триубиквитина на диубиквитин и моноубиквитин в качестве конечных продуктов. (Бекес и др. , 2015). Мониторинг расщепления proISG15, который несет пептид с 8 остатками на С-конце ISG15, показывает, что PLpro также очень активен по отношению к ISG15 (, рис. 1B, ). Процессинг вирусного полипептида включает расщепление между Nsp1-Nsp2, Nsp2-Nsp3 и Nsp3-Nsp4 ( рис. 1A, ).Чтобы контролировать расщепление вирусного полипептида, мы экспрессировали и очищали полноразмерный Nsp1, слитый с первыми 19 аминокислотами Nsp2 (Nsp1-2Δ). При использовании в качестве субстрата в анализах расщепления мы были удивлены, обнаружив, что PLpro не может расщеплять Nsp1-2Δ ( Fig. 1B ). Чтобы подтвердить это наблюдение, мы инкубировали увеличивающиеся концентрации PLpro с Nsp1-2Δ, который все еще был устойчив к расщеплению ( Fig. S1B ).

Рисунок S1:

A) Анализ DUB , показывающий специфичность полиубиквитиновой связи PLpro.

B) Анализ, показывающий влияние увеличения концентрации PLpro на расщепление Nsp1-2Δ, визуализированное окрашиванием Кумасси.

C) Анализ, показывающий расщепление Nsp1-2Δ указанными конструкциями PLpro (1) и Nsp3 (2-5) (цветовая кодировка, как на фиг. 1A).

D) Выравнивание последовательностей С-концов всех субстратов PLpro с выделением сайта расщепления и консенсусного мотива узнавания.

E) Анализ расщепления, сравнивающий активность WT и C856A Nsp3 против K48-связанного Ub3.

F) Анализ, контролирующий превращение PLpro и Nsp3 с помощью зонда HALO-Nsp1-prg.

G) Кинетика Михаэлиса-Ментен расщепления K48-Ub3 под действием PLpro и Nsp3.

Рисунок 1: Полноразмерный Nsp3 является более активной протеазой по сравнению с PLpro

A) Схема расщепления Nsp1-3 PLpro от вирусного полипептида и доменная структура Nsp3: Ubl (убиквитин-подобный домен), ADRP ( АДФ-рибоза фосфатаза, SUD (уникальный домен SARS), PLpro (папаин-подобная протеаза), NAB (домен связывания нуклеиновой кислоты), TM (трансмембранный домен), ZnF (мотив цинкового пальца).

B) Анализ расщепления , сравнивающий способность 50 нМ PLpro расщеплять 3 мкМ K48-связанный Ub3, proISG15 и Nsp1-2Δ, визуализированный окрашиванием серебром.

C) Кумасси-окрашенный гель конструкций Nsp3, используемых в этом исследовании, со схемой сопутствующих доменов (цветовая кодировка, как в 1A; двойная косая черта указывает на делецию).

D) Анализ расщепления , сравнивающий способность 50 нМ Nsp3 расщеплять 3 мкМ K48-связанного Ub3, ISG15 и Nsp1-2Δ.

E) Анализ расщепления, сравнивающий расщепление Nsp1-2Δ и Nsp1-2Δ мутанта G180A Nsp3.

F) Анализ протеазы, сравнивающий расщепление Nsp1-2 FL с помощью PLpro и Nsp3.

G) Анализ DUB , непосредственно сравнивающий расщепление Ub3 (верхний) и ISG15 (нижний) PLpro и Nsp3.

H) Анализ прямого сравнения расщепления Nsp1-2Δ PLpro и Nsp3.

I) DUB-анализ, показывающий предпочтение полиубиквитинового связывания Nsp3.

J) УФ-следы анализов гель-фильтрации (Superdex 200 3.2/300) Nsp3, наложенные на стандарты молекулярной массы.

K) Масс-фотометрический анализ с измерением молекулярной массы Nsp3.

Мы задались вопросом, могут ли элементы распознавания вне минимального домена PLpro быть ответственными за обнаружение и расщепление Nsp1-2Δ. Nsp3 представляет собой мультидоменный белок, содержащий трансмембранный сегмент, который опосредует его локализацию в мембранных везикулах ( Fig 1A ) (Imbert et al , 2008; Lei et al , 2018). В дополнение к протеазному домену Nsp3 содержит N-концевой Ubl (убиквитин-подобный домен), за которым следует ADRP (ADP-рибозо-фосфатаза, домен SUD (SARS-уникальный домен), другой домен Ubl, который является частью PLpro.C-конец протеазы представляет собой домен NAB (связывающий нуклеиновую кислоту), за которым следует TM (трансмембранный сегмент) и домен ZnF (цинковый палец) на самом C-конце (Lei et al. , 2018; Tan et al. , 2009 г.). Несмотря на то, что это большой мультидоменный белок, мы получили миллиграммы чистых и стабильных рекомбинантных усечений Nsp3, когда мы либо удалили, либо заменили трансмембранный сегмент и кислотный участок на N-конце линкером ( Fig 1C ). Поскольку все варианты Nsp3 были одинаково активны ( фиг. S1C ), для дальнейшей характеристики были выбраны остатки 179-1329, охватывающие Nsp3 (далее обозначаемые как Nsp3).Сначала мы сравнили эффективность расщепления трех субстратов с использованием 50 мкМ Nsp3, той же концентрации, что и PLpro, используемого в Fig 1B , которое показало, что расширенные версии Nsp3, в отличие от PLpro, активно расщепляют все три субстрата, включая Nsp1-2Δ ( Fig 1D ). С-конец всех субстратов PLpro содержит мотив -GG с расщеплением PLpro после последнего Gly ( Fig S1D ). Действительно, мутация C-концевого G180 Nsp1 делает его устойчивым к расщеплению Nsp3, как и мутация каталитического C856 Nsp3 в Ala ( Рис. 1E, S1E ), подтверждая, что расширенный Nsp3 поддерживает субстратную специфичность и не содержит дополнительных каталитические сайты протеаз.Затем мы сделали пропаргилированный Nsp1 (Nsp1 Prg ), реактивный зонд, который будет ковалентно модифицировать каталитический Cys PLpro и Nsp3 (Ekkebus et al , 2013). Действительно, в то время как Nsp3 был эффективно модифицирован Nsp1 Prg , практически не наблюдалось никакого превращения для PLpro ( Fig S1F ). Протестированный субстрат Nsp1-2 содержит только 19 аминокислот из Nsp2. Чтобы проверить, имеет ли значение присутствие интактного Nsp2, мы экспрессировали и очищали слияния полной длины Nsp1-Nsp2.При использовании в качестве субстрата мы снова обнаруживаем, что PLpro все еще неспособен расщеплять этот субстрат, тогда как Nsp3 эффективно расщепляет его ( Fig 1F ).

Затем мы сравнили активность PLpro и Nsp3 для каждого из субстратов в качественных анализах на основе геля. В случае полиубиквитина почти весь триубиквитин расщепляется Nsp3 (50 нМ) через 15 минут, тогда как значительная часть еще должна расщепляться PLpro (, рис. 1G, , вверху). Точно так же Nsp3 (20 нМ) расщепляет большую часть про-ISG15 за 15 минут, в то время как только ~ 50% расщепляется PLpro ( рис. 1G, нижний ).С субстратом Nsp1-2Δ Nsp3 (1 мкМ) способен расщепляться, в то время как PLpro – нет ( Рис. 1H ). Эти качественные анализы позволяют предположить, что Nsp3 является более активным ферментом. Чтобы подтвердить эти наблюдения, мы использовали анализ DUB на основе MALDI TOF (Ritorto et al , 2014), который показывает, что PLpro эффективно расщепляет тримеры K48 с помощью тримеров K m из 29,39 µ M, a V макс 0,66 мкМ * мин -1 и ак cat 22 мин -1 ( Fig S1G ).Напротив, Nsp3 расщепляет связанный с K48 триубиквитин с помощью K m 17,79 µ M, V max 0,62 мкМ * min -1 и ak cat 20,6 минут – 1 . Сравнительно более низкое значение K m Nsp3 потенциально объясняет наблюдаемую более высокую активность расщепления. Несмотря на то, что Nsp3 более активен, чем PLpro, он все еще сохраняет свою специфичность в отношении расщепления K48-связанного полиубиквитина и не расщепляет никакие другие протестированные связи ( Fig. 1I, ).

Несмотря на несколько попыток, нам не удалось кристаллизовать более длинные варианты Nsp3 самостоятельно или в комплексе с субстратом. Интересно, что Nsp3 элюируется с кажущейся молекулярной массой ~ 520 кДа на колонке для эксклюзионной хроматографии, что повышает вероятность того, что он может быть тетрамером ( Fig. 1J ). Однако масс-фотометрический анализ показывает, что Nsp3 является мономером ( Fig. 1K ), предполагая, что поведение при гель-фильтрации можно отнести к расширенной конформации или содержанию спиральной спирали в Nsp3.Получение структуры Nsp3 в комплексе с его субстратом может показать, почему он более активен по сравнению с PLpro и почему он может расщеплять Nsp1-Nsp2.

Интерактом PLpro и Nsp3

Поскольку мы наблюдаем различия в активности протеаз между Nsp3 и PLpro, мы затем хотели сравнить интерактомы PLpro и Nsp3. На сегодняшний день большинство попыток всестороннего определения интерактомов неструктурных белков SARS-CoV-2 не смогли идентифицировать интерактом Nsp3 (Gordon et al , 2020).Когда мы экспрессировали полноразмерный Nsp3 в клетках HEK 293, мы наблюдали очень низкие уровни экспрессии, что затрудняло получение достаточного количества материала для анализа аффинного обогащения / масс-спектрометрии (AE / MS). Следовательно, мы сделали усечение, удалив трансмембранные сегменты Nsp3 (Nsp3 ΔTM). Линию эпителиальных клеток легких A549 трансфицировали либо с помощью Strep-меченного Nsp3 TM, либо PLpro, и клетки лизировали после стимуляции IFN-α в течение 36 часов.

Количественный масс-спектрометрический анализ показал, что Nsp3 ΔTM и PLpro имели в значительной степени перекрывающийся интерактом ( Рисунок 2) .Интересно, что многие из интеракторов, обогащенных как PLpro, так и NSP3 ΔTM, стимулируются интерфероном и белками, участвующими в передаче противовирусных сигналов. С его предпочтением расщеплять ISG15, мы наблюдали ISG15 как значимый интерактор, который также был идентифицирован в интерактоме PLpro CoV-2 (Shin et al , 2020). Другие известные перекрывающиеся взаимодействия включают IFIT (интерферон-индуцированный белок с тетратрикопептидными повторами), IFIT1 и IFIT2, противовирусные белки, которые функционируют как сенсоры вирусных одноцепочечных РНК для подавления экспрессии вирусных матричных РНК (Diamond & Farzan, 2013).Nsp3 ΔTM также взаимодействует с противовирусными белками SAMHD1, которые связываются с нуклеотидами и истощают клеточные dNTP, и 1′-5′-олигоаденилатсинтазой 3 (OAS3), другим индуцированным интерфероном геном, который ингибирует репликацию вируса за счет разрушения вирусной РНК (Li et al. al , 2016). Кроме того, как PLpro, так и Nsp3 ΔTM взаимодействуют с многофункциональной АТФ-зависимой РНК-геликазой DDX3X, которая способствует активации IRF3, что приводит к продукции интерферонов типа I, IFN- α и IFN- β (Soulat et al , 2008).

Рисунок 2: Сравнение Nsp3 и PLpro interactome График

Volcano, показывающий значимые взаимодействия, идентифицированные путем извлечения Nsp3 ΔTM или PLpro из временно трансфицированных клеток с последующей количественной масс-спектрометрией. Интерактивные элементы, обогащенные раскрывающимися списками PLpro, выделены синим, а те, которые обогащены раскрывающимися списками Nsp3, выделены красными кружками.

Наши данные также идентифицируют интеракторы, связанные с трансляцией (EIF5A2, EIF2S1, ICE1, EIF2S3L) и актиновый цитоскелет (Cofilin-1, тубулины, KIF9, MYL4, PDLIM5), что также наблюдалось в недавнем исследовании с использованием метки близости ( Laurent et al , 2020).Хотя большинство интеракторов в значительной степени перекрываются между Nsp3 ΔTM и PLpro, мы идентифицируем РНК-связывающий белок 1, связанный с синдромом умственной отсталости Fragile X (FXR1), как обогащенный только Nsp3 ΔTM. Интересно, что Nsp3 из вируса Sindbis взаимодействует с FXR1, чтобы связывать вирусные РНК для сборки вирусных репликационных комплексов (Kim et al , 2016).

Несмотря на наличие нескольких дополнительных доменов, никаких дополнительных уникальных взаимодействий для Nsp3 ΔTM выявлено не было. Мы объясняем отсутствие дополнительных взаимодействий с Nsp3 ΔTM следующими возможностями: (i) Nsp3, используемый в наших экспериментах, не имеет трансмембранного сегмента и, следовательно, не локализуется в правом субклеточном компартменте, где могут присутствовать соответствующие клеточные взаимодействия Nsp3; (ii) большинство взаимодействий с Nsp3, i.е., домен Ubl1, домен SUD и макродомен связаны с РНК или АДФ-рибозой, и (iii) Nsp3 предположительно функционирует как каркас, опосредующий связывание с другими Nsps с образованием репликативных органелл, что объясняет отсутствие взаимодействий с белками человека. . Действительно, Y2H идентифицировал несколько взаимодействий Nsp3 с другими вирусными Nsp, но функциональные последствия этих взаимодействий для жизненного цикла вируса неясны (Pan et al , 2008; Imbert et al , 2008; von Brunn ). et al , 2007).

Идентификация и характеристика ингибиторов PLpro

Мы использовали ранее разработанный анализ MALDI-TOF DUB (Ritorto et al , 2014), чтобы оценить способность одобренных FDA лекарств 1971 года ингибировать PLpro от SARS-CoV-2. Важно отметить, что биоактивность и безопасность этих соединений были проверены в клинических испытаниях, что позволило быстро использовать любые эффективные соединения в терапии для лечения COVID-19. По сравнению с другими подходами на основе флуоресценции, анализ на основе MALDI-TOF имеет преимущество использования тримеров убиквитина K48, физиологического субстрата Plpro, для высокопроизводительного скрининга (HTS) (De Cesare et al , 2020).Кроме того, конечными продуктами, образующимися при расщеплении триубиквитина, являются диубиквитин и моноубиквитин, что делает их совместимыми для анализа с использованием анализа MALDI DUB. Реакцию останавливают добавлением 2% TFA и 15 N убиквитина. Чтобы избежать вариабельности от точки к точке, типичной для обнаружения на основе MALDI-TOF, сигнал моноубиквитина нормализуется до сигнала внутреннего стандарта 15 N ( Рисунок 3A, ). Библиотека одобренных FDA лекарств была проверена в двух экземплярах при концентрации 10 мкМ.Значение Z ’обычно используется для определения устойчивости HTS, причем значения Z’ больше 0,5 указывают на надежность анализа (Zhang et al , 1999). Анализ MALDI-TOF DUB дал среднее значение Z ’0,77 ± 0,12 (, фиг. 3B, ). Соединения, возвращающие процентные значения ингибирования> 50%, были идентифицированы как совпадения, и 30 соединений соответствовали этому критерию (частота совпадений 1,5%) (, фиг. 3B, ). Удачные соединения были отобраны и повторно протестированы в 10-точечной дозе-ответной реакции для определения значений IC 50 в отношении как PLpro, так и Nsp3.Результаты на основе MALDI-TOF были дополнительно подтверждены ортогональными гелевыми анализами с использованием триUb, связанного с K48, и про-ISG15 в качестве субстрата ( Рисунок 3D; S3A-C ).

Рисунок S3. Характеристика ингибиторов

Ортогональные гелевые анализы с использованием тримеров K48 ( A, B ) и про-ISG15 ( C ). Тидеглусиб (TID), дисульфирам (DSF), нордигидрогваяретиновая кислота (NDA), тиогуанин (6TG), метимазол (MIZ), бацитрацин (BAC), леналидомид (LEN), ауранофин (AUR) и Iniparib (INI) были испытаны в указанные концентрации относительно PLpro ( A ) и NSP3 ( B , C ). D) Анализ, проверяющий способность GRL0617 ингибировать расщепление Nsp1-2 FL под действием Nsp3

Рисунок 3: Идентификация и характеристика ингибиторов PLpro

A) Схема рабочего процесса анализа MALDI-TOF DUB. Тример K48 инкубируют с PLpro в течение 30 минут при комнатной температуре. Реакцию останавливают добавлением 2% TFA и 15 N убиквитина (в качестве внутреннего стандарта). Ферментативную активность и ингибирование оценивали с помощью MALDI-TOF MS с обнаружением сигналов убиквитина и 15 N убиквитина.

B) FDA одобрило скрининг библиотеки соединений по MALDI-TOF, баллу Z’Prime и распределению данных HTS.

C) Расчет IC50 соединений, возвращающих значения ингибирования> 50% в HTS: тиогуанин, нордигидрогваяретиновая кислота, дисульфирам, ауранофин и тидеглусиб. IC50 рассчитывали как для PLpro, так и для NSP3 с использованием анализа MALDI-TOF DUB.

D-E) Ортогональные гелевые анализы, проверяющие активность протеаз PLpro и Nsp3 в отношении тримера K48 и pro-ISG15 в качестве субстратов.Нордигидрогваяретиновую кислоту (NDA), дисульфирам (DSF), ауранофин (AUR) и тидеглусиб (TID) тестировали при указанных концентрациях в сравнении с PLpro и NSP3

F) Расчет IC50 GRL0617 по сравнению с PLpro и NSP3.

G) Оценка селективности положительных совпадений GRL-0617 и HTS против панели из 42 человеческих DUB и вирусной опухоли яичника (vOTU). Соединения тестировали при конечных концентрациях 10 и 1 мкМ M.

На основании этих анализов была подтверждена способность пяти соединений ингибировать PLpro и Nsp3 in vitro (уровень подтверждения = 16.6%): тиогуанин, нордигидрогваяретиновая кислота, дисульфирам, ауранофин и тидеглусиб (, рис. 3C, ). Тиогуанин ингибирует PLpro и Nsp3 с IC 50 4,54 и 8,67 µ M соответственно в анализе на основе MALDI-TOF. Интересно, что, несмотря на этот разумный IC 50 , мы не смогли наблюдать ингибирование PLpro тиогуанином в анализе на основе ортогонального геля. Интересно, что ранее было обнаружено, что тиогуанин ингибирует PLpro SARS (Báez-Santos et al , 2015) и Репликация SARS-CoV-2 (Swaim et al , 2020).

В наших анализах мы идентифицируем нордигидрогваяретиновую кислоту (NDA) как мощный ингибитор PLpro и Nsp3 с IC 50 1,06 и 1,62 мкМ M в анализе на основе MALDI-TOF. NDA – это соединение, извлекаемое из растений, используемое в традиционной медицине для лечения различных заболеваний, которое, как было обнаружено, подавляет многочисленные клеточные мишени (Manda et al , 2020). Его способность ингибировать ряд ферментов на основе цистеина связана с окислительно-восстановительными свойствами его двух катехоловых колец, что приводит к образованию аддуктов цистеина (Manda et al , 2020).Несмотря на его положительные эффекты, основным недостатком этого соединения является его потенциальная токсичность для почек и печени при длительном применении.

Дисульфирам – это тиокарбаматный препарат (коммерчески доступный как Antabuse®), который получил одобрение FDA для лечения алкоголизма и используется более 60 лет (Johansson, 1992). Дисульфирам ранее был идентифицирован с помощью скрининга in silico и анализа флуоресцентного резонансного переноса энергии для ингибирования основной Cys-протеазы SARS-CoV-2, Mpro (Lobo-Galo et al , 2020; Jin et al , 2020) .Дисульфирам также подавляет PLpro CoV2 и Nsp3 с аналогичной эффективностью: 0,69 и 0,66 мкМ M в анализе на основе MALDI-TOF и между 1 и 2,5 мкМ M при оценке с помощью ортогонального анализа на основе геля ( Рисунок 3D -E ). Также было обнаружено, что тидеглусиб, ингибитор гликоген-синтазы-киназы 3 (GSK3), ингибирует основную Cys-протеазу SARS-CoV-2 (Jin et al , 2020). Мы обнаружили, что тидеглусиб сильно ингибирует как PLpro, так и Nsp3 с IC50 0,21 и 1,48 µ M, соответственно, в анализе на основе MALDI-TOF.Аналогичная эффективность тидегусиба была также подтверждена в анализе на основе геля (, рисунок 3D-E ). Ауранофин – это золотосодержащее соединение, используемое для лечения ревматоидного артрита (Roder & Thomson, 2015), которое, как известно, подавляет воспаление и стимулирует клеточный иммунитет. Следует отметить, что недавно было показано, что ауранофин ингибирует репликацию SARS-CoV-2 в клетках человека (Rothan et al , 2020). Интересно, что мы обнаружили, что ауранофин сильно ингибирует PLpro и Nsp3 с эффективностью в диапазоне 1 µ M в анализе на основе MALDI-TOF с аналогичным паттерном ингибирования, наблюдаемым в анализе на основе геля ( Рисунок 3D-E ).Затем мы протестировали GRL-0617, нековалентный ингибитор, ингибирующий PLpro SARS , после вспышки SARS в 2002–2003 гг., С IC 50 0,6 µ M (Ratia et al , 2008 ). Мы обнаружили, что GRL-0617 также ингибирует PLpro с IC 50 2,21 µ M и Nsp3 с IC50 3,39 µ M ( Рисунок 3F ). Высокое сходство последовательностей между PLpro из SARS-CoV и SARS-CoV-2 и консервативный активный сайт объясняют, почему GRL-0617 ингибирует обе протеазы.

Геном человека кодирует около 100 деубиквитинирующих ферментов, большинство из которых являются цистеиновыми протеазами (Clague et al , 2019). Поскольку PLpro имеет общие архитектурные особенности с USP DUB, мы оценили селективность GRL-0617 и пяти положительных результатов HTS, протестировав их при конечных концентрациях 10 и 1 µ M на панели DUB, включающей 42 DUB человека и вирусная опухоль яичников (vOTU) из геморрагического вируса Крымского Конго. Неудивительно, что мы обнаружили, что дисульфирам, тиогуанин, NDA, тидеглусиб и ауранофин подавляли – в разной степени – несколько других человеческих DUB ( Рисунок 3G ), в то время как GRL-0617 показал большую специфичность с меньшим нецелевым ингибированием в панели протестированных DUB. ( Рисунок 3G ).Интересно, что GRL-0617 также способен ингибировать расщепление вирусного полипептида ( Рисунок S3D ). Присутствие высокореактивных химических групп, способных ковалентно модифицировать реактивные цистеины, может объяснять низкую специфичность этих небольших молекул. Несмотря на широкий диапазон активности этих соединений, их относительная безопасность была тщательно оценена в доклинических и клинических испытаниях FDA.

Затем мы проверили эффективность этих соединений в отношении ингибирования PLpro в клеточных анализах, измеряя активацию экспрессии интерферона с использованием репортера люциферазы IFN-β или способность ингибировать репликацию SARS-CoV-2 в клетках CaCo (Shin et al. , 2020).К нашему разочарованию, ни одно из соединений, кроме GRL-0617, не показало никаких эффектов ингибирования PLpro в клетках (данные не показаны). Эти результаты отличаются от результатов, полученных для некоторых из этих ингибиторов. Например, было показано, что использование ауранофина и тиогуанина ограничивает репликацию SARS-CoV-2 (Swaim et al , 2020; Rothan et al , 2020), но основной механизм действия не совсем понятен. Наши данные демонстрируют, что ауранофин и тиогуанин ингибируют деубиквитинирующую активность протеазы PLpro in vitro .Низкая эффективность идентифицированных хитов в ограничении репликации вируса предполагает, что перепрофилирование может быть неэффективной стратегией для идентификации ингибиторов, подходящих для клинической разработки, и для разработки специфических и эффективных ингибиторов PLpro / Nsp3 требуется систематический подход. Наши результаты, показывающие, что расширенные версии Nsp3 могут расщеплять вирусные полипептиды, которые минимальный PLpro не так эффективен, предполагают, что использование Nsp3 для скрининга ингибиторов может привести к идентификации аллостерических ингибиторов, которые могут ингибировать все три активности Nsp3.Несмотря на то, что они не очень эффективны сами по себе, комбинация лекарств, нацеленных на основные протеазы SARS-CoV-2 (PLpro и / или основную протеазу), с другими важными вирусными ферментами, такими как РНК-зависимая полимераза, может представлять собой терапевтическую стратегию.

Разработка нанотел, которые ингибируют PLpro

Поскольку все идентифицированные идентифицированные ингибиторы проявляют нецелевые эффекты и ингибируют другие человеческие DUB, мы хотели разработать другие способы избирательного ингибирования PLpro в качестве стратегии для исследования роли Nsp3 в вирусной жизни. цикла, вмешиваясь в передачу сигналов иммунной системы хозяина, и изучить, может ли ингибирование PLpro эффективно блокировать репликацию вируса.Ранее были разработаны варианты убиквитина (Ubv) для избирательного ингибирования DUB путем связывания с карманом S1 (Zhang et al , 2017; Gorelik & Sidhu, 2017). Следовательно, мы стремились создать нанотело, которое связывается с сайтом S1 с высоким сродством, чтобы ингибировать PLpro. Кроме того, сайт S1 важен как для деубиквитинирующей, так и для деISGилирующей активности PLpro (Békés et al , 2016). Поэтому мы использовали недавно разработанную библиотеку отображения нанотел на поверхности дрожжей, которая была недавно разработана для скрининга и идентификации нанотел (McMahon et al , 2018).Чтобы направить отбор нанотел к сайту S1, нам пришлось отказаться от нанотел, которые распознавали другие области PLpro. Следовательно, мы ввели этап отрицательного отбора с использованием PLpro CoV-2 , несущего мутации в сайте S1. Поскольку эти мутации были разработаны на основе доступной структуры PLpro SARS в комплексе с убиквитином (PDB 4MM3, (Ratia et al , 2014)) ( Fig S4A ), мы сначала проверили, влияют ли эти мутации также на PLpro . Ков-2 . Действительно, по сравнению с WT мутант PLpro CoV-2 не реагировал на пропаргилированный Ub и был неспособен расщеплять связанный с K48 triUb ( Fig S4B-C ).После нескольких раундов отрицательного и положительного отбора с использованием сортировки с магнитно-активированными клетками (MACS), как показано в , фиг. 4A, , отдельные клоны дрожжей были протестированы на их связывание с PLpro (, фиг. 4B, ). Интересно, что мы идентифицировали несколько нанотел, которые связывались с WT PLpro CoV-2 , но не с мутантом сайта S1, предполагая, что эти нанотела специфически связываются с сайтом S1 (NbSL-17, -18, 19). Секвенирование этих нанотел выявило различия в петлях CDR1, CDR2 и CDR3 различных нанотел.

Рисунок 4: Разработка нанотел, которые ингибируют Nsp3

A) Схематический рабочий процесс выбора дисплея поверхности дрожжей для идентификации сайт-специфических нанотел как конкурентных ингибиторов Nsp3.

B) Анализ проточной цитометрии дрожжей, демонстрирующий нанотела против Nsp3 NbSL17, NbSL18 или NbSL19 соответственно. Дрожжи окрашивали анти-HA-Alexa488 против HA-меченного Nb и стрептавидин-Alexa647 против биотинилированных антигенов. Вверху: дрожжи, инкубированные с PLpro дикого типа, внизу: дрожжи, инкубированные с мутантом PLpro S1 *.Проценты указывают на долю дрожжей, положительных для обеих флуоресцентных меток.

C) УФ-следы и окрашенный кумасси SDS-PAGE анализов гель-фильтрации комплексов PLpro-Nb. Только PLpro (черный), PLpro + NbSL17 (оранжевый) и PLpro + NbSL18 (синий).

D-F) Изотермическое калориметрическое титрование для измерения связывания PLpro с NbSL18 (D), ISG15 (E) или K48-Ub2 (F).

G) Окрашенные серебром гели DUB-анализов PLpro (слева) и Nsp3 (справа) с K48-Ub3 (вверху) и proISG15 (в центре) и Nsp1-2 FL (внизу) в качестве субстратов в присутствии возрастающих концентраций из NbSL18.Окрашенные серебром гели SDS-PAGE. См. Также Рисунок S4 .

Рисунок S4: Дизайн мутанта PLpro S1 * и идентифицированные последовательности ингибирующих нанотел

A) Структура SARS-CoV PLpro (синий), связанный с убиквитином (зеленый) (PDB 4MM3). Стик-модели показывают остатки мутантного сайта связывания S1 (золото) и каталитический цистеин C856. Ярлыки указывают на правую архитектуру PLpro с поддоменами Fingers, Palm и Thumb.

B) Гель, окрашенный Кумасси, сравнивающий реактивность PLpro WT и мутанта S1 * с Ub-prg

C) Анализ DUB PLpro WT и мутанта S1 * с K48-Ub3 в качестве субстрата, визуализированный окрашиванием серебром

DE) DUB-анализы PLpro (D) и Nsp3 (E) с K48-Ub3 (вверху) и proISG15 (внизу) в присутствии возрастающих концентраций NbSL17.

F) Выравнивание последовательностей идентифицированных ингибирующих нанотел NbSL17, NbSL18 и NbSL19 с синтетическим нанотелом Nb.201 (PDB 5VNV). Элементы вторичной структуры и расположение определяющих комплементарность областей (CDR) указаны над последовательностью.

Чтобы дополнительно охарактеризовать эти нанотела, они были рекомбинантно экспрессированы и очищены от бактерий. Из трех идентифицированных нами индивидуальных последовательностей нанотел растворимая экспрессия была получена только для двух нанотел (NbSL17 и NbSL18).Сначала мы выполнили аналитическую гель-фильтрацию, которая идентифицировала NbSL18 с образованием комплекса с PLpro CoV-2 (, рис. 4C, ). Используя калориметрию изотермического титрования (ITC), мы обнаружили, что аффинность связывания NbSL18 с PLpro CoV-2 составляет ~ 500 нМ ( Fig. 4D ). Интересно, что мы не наблюдаем никакого детектируемого связывания PLpro для K48-связанного diUb или ISG15 с помощью ITC ( Fig. 4E , F ). Поскольку NbSL18 связывается с PLpro с более высокой аффинностью по сравнению с K48-связанным diUb, мы затем оценили способность NbSL18 ингибировать PLpro.При увеличении концентрации NbSL18 расщепление K48-связанного triUb с помощью PLpro ингибируется с ~ 50% ингибированием при 500 нМ NbSL18, что согласуется с аффинностью связывания NbSL18 с PLpro ( рис. 4G, ). Напротив, для ингибирования расщепления ISG15 требуются более высокие концентрации NbSL18. Недавние кристаллические структуры ISG15 в комплексе с PLpro CoV-2 показывают, что C-концевой UBL ISG15 использует несколько иной способ взаимодействия по сравнению с убиквитином (Shin et al , 2020; Klemm et al , 2020) , что объясняет различия в ингибировании активности деубиквитилирования и деИСГилирования с помощью NbSL18.

Понимание того, как вирусный полипептид распознается Nsp3, и использование этого для ингибирования высвобождения зрелого Nsp1 / 2/3 может представлять собой законную стратегию подавления репликации вируса. Nsp1, например, играет ключевую роль в процессе инфекции, связываясь с субъединицами рибосомы 40S хозяина и блокируя канал мРНК своим С-концевым доменом, тем самым подавляя трансляцию белков-хозяев и изолируя рибосомы для трансляции вирусных белков. Следовательно, предотвращение созревания Nsp1 из вирусного полипептида может иметь жизненно важное значение для препятствования репликации вируса (Schubert et al , 2020; Thoms et al , 2020).Поэтому мы проверили, может ли NbSL18 также ингибировать расщепление слияний Nsp1-Nsp2 FL. Интересно, что наши данные показывают, что NbSL18 действительно может ингибировать расщепление Nsp1-2 FL с помощью Nsp3, предполагая, что вирусный пептид также занимает тот же сайт S1, что и убиквитин ( Fig. 4H ).

Определение кристаллической структуры NbSL18 в комплексе с Nsp3 или PLpro пролило бы свет на способ взаимодействия и позволило бы нам конструировать мутации, чтобы не только увеличить сродство связывания, но и избирательно ингибировать активность деубиквитилирования, деISGилирования или процессинга вирусных полипептидов.Однако, несмотря на несколько попыток, получить хорошо дифрагирующие кристаллы не удалось. Тем не менее, разработанные здесь нанотела могут быть ценными инструментами для анализа относительного вклада трех различных пептидазных активностей Nsp3 в репликацию вируса и инфекцию. Таким образом, наша работа выявляет различия в активности протеаз между минимальным PLpro доменом Nsp3 и более длинными версиями Nsp3 и подчеркивает необходимость изучения механизма Nsp3. Кроме того, текущие усилия по разработке ингибиторов сосредоточены исключительно на PLpro, и наши результаты показывают, что было бы важно оценить не только их эффективность при ингибировании полноразмерного Nsp3, но также способность протеазы расщеплять вирусные полипептиды.

Материалы и методы

Конструкции кДНК

кДНК ISG15 человека амплифицировали с помощью ОТ-ПЦР из универсальной эталонной РНК человека (Agilent 740000-41), добавляя сайты рестрикции BamHI и NotI на 5 ’и 3’ концах соответственно. Расщепленный продукт ПЦР клонировали в pGEX6P1, разрезанный теми же ферментами, чтобы получить pGEX6P1 ISG15 (DU8371).

кДНК убиквитина амплифицировали из существующего клона DU8724 (pET15b 6His 3C Ubiquitin), добавляя сайты рестрикции NdeI и BamHI на 5 ’и 3’ концах соответственно.Расщепленный продукт ПЦР клонировали в pET24a, разрезанный теми же ферментами, чтобы получить убиквитин pET24a (DU20027).

кДНК, кодирующие остатки SARS CoV-2 (MN7.3) Nsp3 743-1072 (PL-pro) и остатки SARS CoV-2 Nsp3 743-1072 (PL-pro) E912R E948R M953E Y1013K были синтезированы NBS Biologicals ( www.nbsbio.co.uk) с сайтами 5 ‘BamHI и 3’ NotI. Последовательности были оптимизированы по кодонам для бактериальной экспрессии. Их субклонировали в рецепторный вектор pETDuet 6His TEV GST 3C AVi (DU68478), расщепленный BamHI и NotI, чтобы получить pETDuet 6His TEV GST 3C AVi SARS CoV-2 Nsp3 PL-pro (DU67765) и pETDuet 6His TEV GST 3VC AVi Nsp3 PL-pro E912R E948R M953E Y1013K (DU67766).

pETDUET 6HIS TEV GST 3C SARS-CoV-2 Nsp3 743-1072 (PL-pro) (DU67811) получали путем удаления последовательности тега avi из DU67765 с помощью мутагенеза ПЦР.

кДНК, кодирующая SARS CoV-2 Nsp1 1-180 Nsp2 1-19 8His, была синтезирована GeneArt (Thermo Fisher Scientific) с добавлением сайтов NcoI и NotI на 5 ’и 3’ концах соответственно. Эту последовательность субклонировали в pET28a, чтобы получить pET28a SARS-CoV-2 Nsp1 1-180 Nsp2 1-19 8His (DU67799).

pTXB1 Halo 3C SARS-CoV-2 (2019-nCoV) Nsp1 1-179-Intein CBD (DU67780 был получен с использованием NEBuilder (New England Biolabs), амплификации вектора из существующего клона DU28033 (pTXB1-HALO-Mxe Intein-CBD) ) и вставка Nsp1 1-179 из существующего клона DU66413 (pGEX6P1 2019-nCoV Nsp1).

pET15D Twinstrep 3C Nsp3 N179-N1329 6His (DU67831) получали с использованием NEBuilder, амплифицируя вектор из существующего клона DU67810 (pET15D Twinstrep 3C 6His) и последовательность вставки Nsp3 179-1329 Nsp3 179-1329 из плазмиды Addgene pSD-ON-R 142012 pSD-2 .

pET15D Twinstrep 3C Nsp3 1-109 Линкер 179-1329 6His (DU67844) был получен с использованием NEBuilder, амплифицируя вектор из DU67831 и Nsp3 1-109 с линкерной последовательностью из плазмиды Addgene 141257 pDONR207 SARS-CoV-2 Nsp3.

pET15D Twinstrep 3C Nsp3 N179-N1329 Линкер 1584-1944 6His (DU67847) был получен с использованием NEBuilder, амплифицируя вектор из pET15D Twinstrep 3C Nsp3 179-1329 6His (DU67831) и линкер + последовательность Nsp3 1584-19 pDONR207 SARS-CoV-2 Nsp3.

pET15D Twinstrep 3C Nsp3 A1-N1329 Linker 1584-1944 6His (DU67881) был получен с использованием NEBuilder, амплификации вектора из существующего клона pET15D Twinstrep 3C-6His (DU67810) и вставки Nsp3 A1-N1329 Linker из существующего клона 1584-1944 pcDNA5D FRT / TO Twinstrep 3C Nsp3 A1-N1329 Линкер 1584-1944 6His IRES HA Nsp1 M1-G180 (DU67868).

pET15D Twinstrep 3C SARS-CoV-2 Nsp3 N179-N1329 6His C856A (DU67898) был получен путем добавления мутации C856A к клону DU67831 с использованием мутагенеза ПЦР.pET15D 8His GST 3C Nsp1-Nsp2 (DU70079) был получен путем повторной амплификации последовательности Nsp1-Nsp2 из существующего клона pcDNA5 FRT / TO Sars CoV-2 Nsp1-Nsp2-Nsp3 A1-G1944-GFP (DU70082) (сгенерированный непосредственно NEBuilder), переваривание BamHI и NotI и клонирование в существующую плазмиду pET15D 8His GST (DU70054), разрезанную теми же ферментами.

pcDNA5D FRT / TO mCherry (DU41458) был получен путем амплификации последовательности mCherry плюс mcs и клонирования в сайты BspTI и NotI pcDNA5D FRT / TO (DU41459), производного pcDNA5 FRT / TO (Thermo Fisher).

pcDNA5D FRT / TO Twinstrep 3C Nsp3 A1-N1329 Linker 1584-1944 6His (DU67879) был получен путем повторной амплификации Twinstrep 3C Nsp3 A1-N1329 Linker 1584-1944 6His из pcDNA5D FRT TO Twinstrep 3C Nsp329 A1His Linker 1584-1944 6His IRES HA Nsp1 M1-G180 (DU67868) (сделано NEBuilder) и клонирование в pcDNA5D FRT / TO (DU41459) BglII / NotI в BamHI / NotI.

pcDNA5D FRT / TO Twinstrep 3C SARS CoV-2 Nsp3 743-1072 (PL-pro) (DU67916) был получен путем удаления HA и замены Twinstrep 3C с использованием сайт-направленного мутагенеза Q5 (New England Biolabs E0552S) в pcDNA5D FRT / К HA SARS-CoV-2 Nsp3 743-1072 (PL-pro) (DU67767).pcDNA5D FRT / TO HA SARS-CoV-2 Nsp3 743-

1072 (PL-pro) (DU67767) был получен путем клонирования синтезированной последовательности SARS-CoV-2 Nsp3 743-1072 (PL-pro) в pcDNA5D FRT / TO HA (DU41456) с использованием BamHI / NotI.

Все реакции ПЦР проводили с использованием ДНК-полимеразы KOD Hot Start (Novagen). Все ОТ-ПЦР проводили с использованием набора PrimeScript High Fidelity RT-PCR компании Takara (R022A).

Секвенирование ДНК было выполнено MRC PPU DNA Sequencing and Services, School of Life Sciences, University of Dundee (www.dnaseq.co.uk).

См. Таблица S1 для обзора конструкций, используемых в этом исследовании. Все описанные здесь конструкции могут быть получены из https://mrcppu-covid.bio/

Экспрессия и очистка белка

Все рекомбинантные белки были экспрессированы в клетках E. coli BL21-CodonPlus (DE3). Бактериальные культуры выращивали в среде 2x TY с добавлением 100 µ мкг / мл ампициллина до OD 600 0,6-0,8 при 37 ° C в инкубаторах с встряхиванием. Экспрессию белка индуцировали добавлением 300 мкМ M IPTG с последующей инкубацией в течение ночи при 18 ° C.Клетки собирали при 4200 об / мин в течение 30 минут и осадки суспендировали в буфере для лизиса (50 мМ трис-HCl pH 7,5, 300 мМ NaCl, 10% глицерин, 0,075% об. / Об. BME, 1 мМ бензамидин, 1 мМ AEBSF и полный раствор). таблетка коктейля ингибиторов протеазы (Roche). Затем ресуспендированные клетки лизировали ультразвуком и осветляли центрифугированием при 35000 g в течение 45 минут при 4 ° C.

His
6 -GST-PLpro

Осветленный лизат инкубировали с His60 Ni Superflow Смола (TaKaRa) в течение 1 часа при 4 ° C. Смолу промывали буфером (300 мМ NaCl, 50 мМ Трис, pH 7.5) с добавлением увеличивающихся концентраций имидазола. Белок элюировали 300 мМ имидазолом. Затем элюент инкубировали с GSH-сефарозой (BRAND) в течение 1 часа перед промыванием буфером с высоким содержанием соли (500 мМ NaCl, 50 мМ Трис, pH 7,5, 5-10 мМ DTT), а затем буфером с низким содержанием соли (150 мМ NaCl, 50 мМ Трис. pH 7,5, 1 мМ ДТТ). Смолу инкубировали с буфером с низким содержанием соли, дополненным протеазой PreScission o / n, при 4 ° C для расщепления GST-метки. Белок элюировали и концентрировали (Amicon Centrifugal Filter Units, Merck) с последующей эксклюзионной хроматографией (Superdex 75 16/60, Cytiva) в подходящем буфере (20 мМ трис-HCl, pH 7.5, 150 мМ NaCl, 1 мМ ДТТ).

TwinStrep-Nsp3

Затем осветленный лизат фильтровали через шприц-фильтр с размером пор 0,45 микрон и очищали с помощью аффинной хроматографии (StrepTrap, Cytiva). Колонку тщательно промывали буфером S (50 мМ Трис-HCl pH 7,5, 300 мМ NaCl, 1 мМ DTT), и белок элюировали буфером S с добавлением 10 мМ дестиобиотина. Затем белок дополнительно очищали анионообменной хроматографией (Resource Q, Cytiva) и элюировали в градиенте буфером Q (50 мМ Трис-HCl, pH 8.5, 1 М NaCl, 1 мМ DTT) с последующей эксклюзионной хроматографией (Superdex 200 16/60, Cytiva) в подходящем буфере (20 мМ Tris-HCl pH 7,5, 300 мМ NaCl, 1 мМ DTT).

K48-Ub3

Немеченый моноубиквитин очищали, как описано ранее, и цепи полиубиквитина синтезировали и очищали, как описано ранее (Kristariyanto et al , 2015).

proISG15

Осветленный лизат инкубировали с GSH-сефарозой в течение 1 часа. Затем смолу промывали буфером с высоким содержанием соли (500 мМ NaCl, 50 мМ Трис, pH 7.5, 5 10 мМ DTT), а затем буфер с низким содержанием соли (150 мМ NaCl, 50 мМ Tris pH 7,5, 1 мМ DTT). Смолу инкубировали с буфером с низким содержанием соли, дополненным протеазой PreScission o / n, при 4 ° C для расщепления GST-метки. Белок элюировали и концентрировали (Amicon Centrifugal Filter Units, Merck) с последующей эксклюзионной хроматографией (Superdex 75 16/60, Cytiva) в 20 мМ трис-HCl pH 7,5, 150 мМ NaCl, 1 мМ DTT.

Nsp1-2Δ-His
8

Осветленный лизат инкубировали со смолой His60 Ni Superflow (TaKaRa).Смолу промывали буфером (300 мМ NaCl, 50 мМ Трис, pH 7,5) с добавлением возрастающих концентраций имидазола. Белок элюировали 300 мМ имидазолом. Белок элюировали и концентрировали (Amicon Centrifugal Filter Units, Merck) с последующей эксклюзионной хроматографией (Superdex 75 16/60, Cytiva) в подходящем буфере (20 мМ Tris-HCl pH 7,5, 150 мМ NaCl, 1 мМ DTT).

Nsp1-2 FL

Осветленный лизат инкубировали со смолой His60 Ni Superflow (TaKaRa) в течение 1 часа при 4 ° C.Смолу промывали буфером (300 мМ NaCl, 50 мМ Трис, pH 7,5) с добавлением возрастающих концентраций имидазола. Белок элюировали 300 мМ имидазолом. Затем элюент инкубировали с GSH-сефарозой (BRAND) в течение 1 часа перед промыванием буфером с высоким содержанием соли (500 мМ NaCl, 50 мМ Трис, pH 7,5, 5-10 мМ DTT), а затем буфером с низким содержанием соли (150 мМ NaCl, 50 мМ Трис. pH 7,5, 1 мМ ДТТ). Смолу инкубировали с буфером с низким содержанием соли, дополненным протеазой PreScission o / n, при 4 ° C для расщепления GST-метки. Белок собирали, наносили на колонку Resource Q объемом 6 мл и элюировали градиентом буфера Q (50 мМ Трис, pH 8.5, 1000 мМ NaCl). Пиковые фракции концентрировали (Amicon Centrifugal Filter Units, Merck) с последующей эксклюзионной хроматографией (Superdex 75 16/60, Cytiva) в подходящем буфере (20 мМ Tris-HCl pH 7,5, 150 мМ NaCl, 1 мМ DTT).

Качественные анализы протеазы

PLpro и Nsp3 разбавляли в буфере A (50 мМ Трис-HCl pH 7,5, 50 мМ NaCl, 10 мМ DTT) до и инкубировали при комнатной температуре в течение 10 минут для полного восстановления каталитического цистеина. Для большинства анализов протеазного расщепления 3 мкМ субстрата инкубировали с различными концентрациями PLpro и Nsp3.Для анализов, сравнивающих относительную активность каждой протеазы по отношению к панели субстратов и оценки специфичности связывания, использовали 50 нМ Plpro / Nsp3. Для анализов, сравнивающих относительную активность PLpro и Nsp3 с Nsp1-2 FL, Ub3, proISG15 и Nsp1-2Δ, соответствующие концентрации ферментов составляли 50 нМ (Nsp1-2 FL, Ub3), 20 нМ (proISG15) и 1 мкМ (Nsp1- 2Δ). Для анализа, сравнивающего расщепление Nsp1-2 (Δ) G180A относительно WT под действием Nsp3, и анализа, сравнивающего расщепление Nsp1-2Δ всеми конструкциями Nsp3, 5 мкМ протеазы инкубировали с 10 мкМ субстратом.Для анализа, в котором увеличивающиеся концентрации PLpro инкубировали с Nsp1-2Δ, использовали 10 мкМ субстрат. Все анализы проводили при 30 ° C и гасили в указанные моменты времени, добавляя загрузочный краситель LDS. Образцы разделяли на 4-12% геле SDS-PAGE (Life Technology) и окрашивали серебром с использованием набора для окрашивания Pierce Silver (Thermo Fisher).

Получение комплекса Nsp3-Nsp1

prg

Тиоэфир HALO-Nsp1 был получен после расщепления интеина, как описано ранее для убиквитина (Borodovsky et al ., 2002). Буфер HALO-Nsp1-тиоэфир заменяли на буфер HEPES (pH 8,0) и подвергали взаимодействию с 250 мМ пропаргиламином (Sigma) в течение 3 часов при комнатной температуре. Затем реактивный зонд отделяли от избытка пропаргиламина с помощью эксклюзионной хроматографии (Superdex 200 16/60, Cytiva) в подходящем буфере (1x PBS). Чтобы проверить реактивность зонда (S1B), 5 мкМ Nsp3 / PLpro инкубировали с 10 мкМ HALO-Nsp1 prg при 30 ° C в течение 1 часа. Реакцию гасили 4-кратным красителем LDS, растворяли на 4-12% геле SDS-PAGE (Life Technology) и окрашивали InstantBlue (BRAND).

Анализы ингибирования малых молекул / нанотел

PLpro и Nsp3 разбавляли в буфере I (50 мМ Tris-HCl pH 7,5, 50 мМ NaCl, 0,01% (мас. / Об.) BSA). DUB предварительно инкубировали с указанной концентрацией низкомолекулярного ингибитора / нанотела в течение 30 минут при комнатной температуре. Конечную концентрацию 50 нМ DUB инкубировали с 3 мкМ субстрата при 30 ° C в течение 1 часа. В указанные моменты времени анализ останавливали добавлением красителя LDS. Образцы разделяли на 4-12% геле SDS-PAGE (Life Technology) и окрашивали серебром с использованием набора для окрашивания Pierce Silver (Thermo Fisher).

Отбор нанотел

Очистка и биотинилирование белка PLpro для отбора нанотел

Осветленные лизаты, содержащие 6His-GST-AVI-PLpro или 6His-GST-AVI-PLpro E912R E948R M953E Y1013K (S1 * мутант His60 Superflow), инкубировали с Смола (TaKaRa) в течение 1 часа при 4 ° C. Смолу промывали 300 мМ NaCl, 50 мМ Трис pH 7,5, 10 мМ имидазолом, 2 мМ BME и белок элюировали добавленным 300 мМ имидазолом. Элюированный белок концентрировали до ~ 100 мкМ М и биотинилировали путем инкубации с 2 мкМ М BirA, 5 мМ MgCl 2 , 2 мМ АТФ и 250 мкМ М биотина в течение 1 часа при 25 ° C.Добавляли дополнительно 250 мкМ М биотина и реакционную смесь инкубировали в течение 1 ч при 25 ° C. Затем реакционную смесь инкубировали с шариками GSH-сефарозы в течение 1 часа при 4 ° C, и смолу промывали 50 мМ Tris pH 7,5, 300 мМ NaCl, 2 мМ BME. 6His-GST-tag удаляли инкубацией с протеазой PreScission в течение ночи при 4 ° C, а биотинилированный белок элюировали из смолы, концентрировали до ~ 1 мг / мл, быстро замораживали в жидком азоте и хранили при -80 ° C. Успешное биотинилирование целевого белка оценивали путем инкубации с 5-кратным избытком стрептавидина в течение 5 минут при 20 ° C с последующим SDS-PAGE анализом индуцированного сдвига молекулярной массы стрептавидинового комплекса.

Выбор синтетических нанотел с помощью дисплея поверхности дрожжей

Сайт-специфические нанотела против PLpro были выбраны из библиотеки нанотел наивных дисплеев дрожжей, которая была разработана и щедро предоставлена ​​лабораторией Kruse (McMahon et al 2018). Дрожжи выращивали в среде YGLC-glu (80 мМ цитрата натрия pH 4,5 (Sigma), 6,7 г / л дрожжевого азотного основания без аминокислот (BD Biosciences), 2% глюкозы, 3,8 г / л Do mix-trp при 30 ° C). ° C и встряхивание при 200 об / мин в течение ночи, и экспрессию нанотел индуцировали инкубацией в среде YGLC-gal (рецепт как YGLC-glu, но с галактозой вместо глюкозы) при 20 ° C и 200 об / мин в течение 48-72 часов.9 дрожжей в 5 мл PBE инкубировали с 400 нМ биотинилированным мутантом PLpro S1 *, иммобилизованным на микрогранулках со стрептавидином (Miltenyi) в течение 40 мин при 4 ° C. Смесь наносили на уравновешенную колонку LD на магнитной стойке, собирали поток, и колонку промывали 2 мл PBM для сбора дополнительных несвязанных дрожжей. Несвязанные дрожжи осаждали при 4 ° C и 2500 г в течение 3 мин и ресуспендировали в 5 мл PBM, содержащем 400 нМ биотинилированного PLpro, иммобилизованного на микрогранулках со стрептавидином, и вращали в течение 1 ч при 4 ° C.8 дрожжей осаждали и ресуспендировали в 500 мкл мкл PBM, содержащем 100 нМ конъюгата стрептавидин-Alexa Fluor 647 (Thermo Fisher) и 400 нМ PLpro S1 * -мутанта, и инкубировали в течение 40 мин при 4 ° C. Дрожжи промывали 1 мл PBM и ресуспендировали в 950 мкл мкл PBM + 50 мкл мкл микрогранул анти-Alexa647 (Miltenyi) и вращали в течение 20 мин при 4 ° C. Дрожжи были отрицательно выбраны на колонке LD, как описано выше. Проточные дрожжи один раз промывали 1 мл PBM и ресуспендировали 500 мкл мкл PBM, содержащего 100 нМ стрептавидин-Alexa647 и 400 нМ биотинилированного PLpro, и инкубировали в течение 2 ч при 4 ° C.Дрожжи промывали 1 мл PBM, ресуспендировали в 950 мкл мкл PBM + 50 мкл мкл микрогранул против Alexa647 и вращали в течение 20 мин при 4 ° C. Дрожжи вносили в колонку LS и элюировали из нее для положительного отбора, как описано выше. Дрожжи выделяли в YGLC-glu и инкубировали в YGLC-gal, как указано выше. Отрицательный выбор третьего и четвертого раундов MACS был идентичен второму раунду, описанному выше. Для положительного отбора в третьем раунде MACS проточные дрожжи инкубировали с 2000 нМ PLpro в 500 мкл мкл PBM в течение 1 ч при 4 ° C, дважды промывали 1 мл PBM, ресуспендировали в 50 нМ стрептавидине-647. в 500 мл PBM и вращали в течение 15 мин при 4 ° C.Дрожжи осаждали и ресуспендировали в 5 мл PBM и положительно отбирали на колонках LS, как описано выше. Четвертый раунд отбора MACS был идентичен третьему раунду, но с пониженной концентрацией PLpro (500 нМ) для положительного отбора. Отбор контролировали с помощью проточной цитометрии на cytoFLEX S (Beckman) путем анализа флуоресцентных сигналов связанных с антигеном (Стрептавидин-647) и общих нанотел (анти-HA-Alexa488, Cell Signaling Technologies), отображаемых на поверхности дрожжей.

Секвенирование и субклонирование нанотел

Дрожжи, полученные после четырех раундов селекции MACS, высевали на агаре YGLC-glu для получения отдельных колоний через 96 ч при 30 ° C.Отдельные дрожжевые колонии собирали и ресуспендировали в 100 мкл мкл 200 мМ ацетата лития и 1% SDS каждая. Суспензию клеток инкубировали в течение 5 минут при 70 ° C, а затем смешивали с 300 мкл л этанола и встряхивали. Смесь центрифугировали при 15k g в течение 3 минут, осадок промывали 70% этанолом и ресуспендировали в 100 мкл л h3O. Клеточный дебрис удаляли центрифугированием при 15k g в течение 1 мин и 1 мкл мкл супернатанта использовали в качестве ДНК-матрицы для 25 мкл мкл ПЦР-реакции (KOD HotStart, Merck) с праймерами NbLib-fwd-i (CAGCTGCAGGAAAGCGGCGG) и NbLib-rev-i (GCTGCTCACGGTCACCTGG) для амплификации последовательности вставки нанотела.Фрагменты ПЦР нанотел анализировали на 2% TAE-агарозных гелях и очищали с помощью набора для экстракции гелей QIAquick (Qiagen). Фрагменты ПЦР секвенировали и индивидуальные нанотела клонировали с использованием набора для клонирования In-Fusion (Takara Bio) в вектор pET28a, линеаризованный с помощью ПЦР с праймерами NbLib_pET28a_fwd (GGTGACCGTGAGCAGCCACCACCACCACCACCACTGAGATCCGCTGCTGCTACCACCGTGCTGCTGCTGCTGCTGCCCGTGCCGTGCCGCCCGTGCCGTGCTGCCCCACCTGCCGCTGCCCGCTGCCGCTG

Измерение ITC

Измерение ITC проводили на приборе MicroCal PEAQ-ITC (Malvern) при 25 ° C.Все белки диализовали в течение ночи при 4 ° C в 50 мМ Tris pH 7,5, 150 мМ NaCl и 0,2 мМ TCEP перед анализом ITC. Данные ITC были подогнаны к односторонней модели связывания (MicroCal Analysis Software, Malvern) для расчета констант связывания.

Трансфекции, лизис и коиммунопреципитации

Альвеолярные эпителиальные клетки человека A549 трансфицировали пустым вектором в трех повторностях или векторами, экспрессирующими SARS CoV-2 Nsp3ΔTM или PLpro, слитые с тегом 2xStrep на N-конце (по 4 повтора каждый).Через 12 часов клетки стимулировали 50 нг / мл IFN- α (Cell Signaling Technologies) в течение 36 часов. Клетки лизировали в ледяном буфере IP (50 мМ Трис-HCl, pH 7,5, 150 мМ NaCl, 0,5% NP-40, 1 мМ AEBSF) и осветляли центрифугированием. Вирусные белки очищали аффинно из 4 мг лизатов путем перемешивания с 40 мкл мкл Strep-Tactin Sepharose (IBA Life Sciences) в течение 90 минут при 4 ° C. Гранулы дважды промывали IP-буфером, содержащим 500 мМ NaCl и 0,5% NP-40, и еще дважды промывали IP-буфером без детергента.90% последней промывки переносили в свежую пробирку LoBind (Eppendorf) для обработки для анализа ЖХ-МС / МС. Остальные 10% были зарезервированы для подтверждения экспрессии вирусного белка и анализа методом вестерн-блоттинга для Nsp3. Эффективная стимуляция IFN- α была подтверждена блоттингом лизатов для ISG15.

Расщепление на гранулах и маркировка TMT

Гранулы из HA-Nsp3, HA-PLpro и контрольной иммунопреципитации ресуспендировали в 100 мкл мкл 100 мМ Трис-Cl (pH 8,0). Белки восстанавливали добавлением конечных 5 мМ DTT и инкубировали на термомиксере при осторожном перемешивании при 56 ° C в течение 20 минут.Затем образцы доводили до комнатной температуры и алкилировали, добавляя в конце 20 мМ йодацетамида, и инкубировали в темноте при комнатной температуре на термомиксере с осторожным перемешиванием в течение 30 минут. Образцы подвергали триптическому расщеплению на гранулах путем добавления буфера для переваривания (2M мочевины + 500 нг трипсина для секвенирования на образец) и инкубировали при температуре 30 ° C на термомиксере в течение примерно 16 часов. После переваривания образцы центрифугировали (при комнатной температуре, 2000g в течение 3 минут) и супернатант собирали в новый 1.Пробирки для сбора 5 мл и подкисляют, добавляя конечный 1% TFA. Затем образцы подвергали очистке пептидом SDB-RP с использованием насадок для стадии SDB-RP собственного изготовления. Вкратце, два диска SDB-RP 16 калибра были упакованы в наконечники для пипеток емкостью 250 мкл. Наконечники столика активировали добавлением 150 мкл загрузочного буфера (1% TFA в изопропаноле об. / Об.) И центрифугировали при 2500 g при комнатной температуре в течение 10 минут. Затем загружали подкисленный пептидный гидролизат и центрифугировали при 2500 g при комнатной температуре в течение 10 минут. Повторно подавали поток и центрифугировали.Наконечники столиков один раз промывали загрузочным буфером и снова промывали промывочным буфером (3% ACN в 0,3% TFA об. / Об.). Наконец, образцы элюировали добавлением 60 мкл элюирующего буфера I (50% ACN в 1,25% Nh5OH об. / Об.) И снова элюировали, добавляя 60 мкл элюирующего буфера II (80% ACN в 1,25% Nh5OH). Элюаты немедленно замораживали и сушили в быстром вакууме.

TMT-маркировка

Пептиды, высушенные в вакууме, восстанавливают в 17 мкл л 50 мМ TEABC (pH 8,0). 3 мкл безводного ACN и 4 мкл реагента TMT (32 мкг репортерной метки TMT) каждой репортерной метки TMT (набор TMT 10 plex, номер продукта: и A37725., Thermo Fisher Scientific) добавляли к каждому образцу и инкубировали при комнатной температуре на миксере Thermo при осторожном перемешивании (600 об / мин) в течение 2 часов. Мечение TMT было выполнено для каждого образца, поскольку HA-PLpro-образец 1-3 был помечен как 126, 127N и 127C, а образец HA-Nsp3 1-4 = 3 был помечен как 128N, 129C и 129N и HA-пустой образец 1-3 были помечены репортерными тегами 129C, 130N и 130C. Затем к каждому образцу добавляли еще 25 мкл мкл 50 мМ TEABC и инкубировали еще 10 минут.Эффективность маркировки TMT была подтверждена путем взятия 5 µ л из каждого образца, помещенного в новую пробирку для сбора, и немедленной вакуумной сушки и обессоливания с использованием наконечника C18 Stage, как описано ранее (Berndsen et al , 2019). Было установлено, что эффективность маркировки TMT составляет> 99%. Далее, каждый образец гасили добавлением 2,5 мкл мкл 5% гидроксиламина и инкубировали при комнатной температуре в течение 10 минут. После этого образцы были объединены и высушены в быстром вакууме. Объединенный пептидный гидролизат, меченный TMT, подвергали мини-фракционированию на микроколонке с обращенной фазой с высоким pH, как описано в (Ruprecht et al , 2017; Berndsen et al , 2019).Всего было приготовлено 8 фракций и объединено в окончательные четыре фракции (FR1 + FR4, FR2 + FR5, FR3 + FR7 и FR4 + FR8), высушены в вакууме и подвергнуты анализу LC-MS / MS.

Анализ LC-MS / MS

Объединенные фракции bRPLC на основе микроколонок восстанавливали в 15 мкл 0,1% муравьиной кислоты и 3% буфера ACN и подвергали анализу LC-MS / MS / MS на Orbitrap Fusion Lumos Tribrid mass. спектрометр, который сопряжен с системой жидкостной хроматографии 3000 RSLC nano. Образец загружали в колонку для улавливания 2 см (PepMap C18 100A – 300 мкм мкм.Номер детали: 160454. Thermo Fisher Scientific) при скорости потока 5 мкл / мин с использованием загрузочного насоса и анализ на аналитической колонке 50 см (колонка EASY-Spray, внутренний диаметр 50 см × 75 мкм, номер детали: ES803) при скорости потока 300 нл / мин. скорость, которая подключается к масс-спектрометру с помощью источника Easy nLC и электрически распыляется непосредственно в масс-спектрометр. Градиент ЖХ применяли от 3% до 30% растворителя-B при скорости потока 300 нл / мин (Растворитель-B: 80% ACN) в течение 105 минут и от 30% до 40% растворителя-B в течение 15 минут и от 35% до 99% растворитель-B в течение 5 минут, который поддерживают на уровне 90% B в течение 10 минут и промывают колонку при 3% растворителе-B в течение еще 10 минут, включая в общей сложности 140-минутный пробег с 120-минутным градиентом в зависимом от данных MS3 режим (FT-IT CID MS2-FT MS3).MS1 полного сканирования был получен с разрешением 120 000 при m / z 200 и измерен с помощью масс-анализатора Orbitrap со сверхвысоким полем. 10 лучших ионов-прекурсоров были нацелены на MS2, а 10 лучших ионов-фрагментов были выделены путем включения синхронного выбора прекурсора для MS3 и проанализированы с помощью масс-анализатора Orbitrap со сверхвысоким полем. Ионы-предшественники выделяли с использованием квадрупольного масс-фильтра с масс-окном 0,7 Да, а спектры MS2 фрагментировали с использованием индуцированной столкновениями диссоциации и регистрировали с помощью масс-анализатора Iontrap в быстром режиме.Верхние 10 фрагментов ионов с изоляционным окном 1,2 Да были изолированы и фрагментированы с использованием столкновительной диссоциации (HCD) пучкового типа при нормированной энергии столкновения 65% и проанализированы с помощью масс-анализатора Orbitrap со сверхвысоким полем с разрешением 50 000 при m / z 200. Мишени AGC были установлены как 2E5 для MS1, 2E4 для MS2 и 5E4 для MS3 с инжекциями ионов 100 мс, 54 мс и 120 мс соответственно.

Анализ данных масс-спектрометрии и биоинформатический анализ

Пакет программ MaxQuant (Тянова и др. , 2016) версия 1.6.10.0 использовался для поиска в базе данных со следующим параметром. Репортерный ион типа MS3: 9plex TMT с толерантностью к массе репортерного иона 0,003 Да. Поправочные коэффициенты изотопного репортерного иона TMT вводились вручную, как указано производителем. Были использованы следующие параметры, специфичные для группы: Использовалась встроенная поисковая машина Andromeda, указав трипсин / P в качестве конкретного фермента, допуская 2 пропущенных расщепления, минимальная длина 7 аминокислот, окисление (M), ацетил (белок-N -терминал), дезамидирование N и Q были выбраны в качестве изменяемых модификаций.Карбамидометилирование Cys было выбрано в качестве фиксированной модификации. Был выбран первый допуск поиска 20 ppm и основной допуск поиска 4,5 ppm. Глобальные параметры: База данных Uniprot Human с добавлением SARS-COV-2 NSP3 с двойным strep-тегом (выпуск 2017-02; 42,101 последовательности) использовалась для поиска в базе данных, и был применен FDR на уровне 1% пептидов и белков. Для количественного определения белка минимальное соотношение было установлено равным 2 для точного количественного определения репортерных ионов. Выходные текстовые файлы групп белков MaxQuant обрабатывали с помощью программного пакета Perseus (Tyanova et al , 2016), версия 1.6.10.45. Данные были отфильтрованы для любых белков, которые помечены как обычные загрязнители и обратные попадания. Интенсивности репортерных ионов TMT были преобразованы в log2, и впоследствии репортерные метки TMT PLpro, NSP3 и контрольные условия были разделены на категории для проведения статистического анализа. T-тест Велча для двух выборок был выполнен с применением 5% -ной перестановки FDR для идентификации дифференциально обогащенных и значимых групп белка между HA-PLPro по сравнению с контрольными и HA-NSP3 по сравнению с контрольными группами.Данные масс-спектрометрической протеомики были депонированы в Консорциум ProteomeXchange через партнерский репозиторий PRIDE (Perez-Riverol et al , 2019) с идентификатором набора данных PXD022904.

MALDI TOF assays

MTP Anchor Chip Планшеты-мишени 1536 BC (№ 8280787) и целевая рамка MTP (№ 8074115) были приобретены у Bruker Daltonics (Биллерика, Массачусетс). Матрица 2 ’, 5’-дигидроксиацетофенона (матрица DHAP) была приобретена у Tokio Chemical Industries (номер продукта: D1955).Растворители и реагенты для ЖХ-МС были приобретены у различных коммерческих поставщиков: ацетонитрил (Merck-Millipore – Кат. № 1.00030.2500), двухосновный цитрат аммония (Fluka – Кат. № 09833), ДМСО (Sigma-Aldrich – Кат. №: D8418), трифторуксусная кислота – TFA (Thermo Scientific – каталожный номер 85183). Анализ проводили в 384-луночном микропланшете, PS, малый объем, hibase, белый (Greiner bio-one – каталожный номер 784904) и покрытый алюминиевой фольгой Silverseal Sealer (Greiner Bio-One – кат. Номер 676090).Для приготовления матричного раствора DHAP 25 мг гидрогенцитрата диаммония растворяли в 1 мл воды milliQ. 7,6 мг матрицы DHAP растворяли в растворе 375 мкл этанола для ЖХ-МС и 125 мкл раствора гидрогенцитрата диаммония с помощью интенсивного встряхивания.

Ферментативные реакции и высокопроизводительный скрининг (HTS) MALDI-TOF были настроены в анализе, как описано ранее (De Cesare et al , 2020). Вкратце, одобренная FDA библиотека соединений была доставлена ​​в планшеты с 384 лунками с использованием бесконтактной акустической доставки.Две колонки были зарезервированы для положительного (только ДМСО) и отрицательного контроля (без фермента). Тример PLpro и K48 убиквитина разбавляли в буфере, содержащем 40 мМ Трис (pH 7,5) и 0,01% BSA до конечной концентрации 1,2 нг / мкл и 0,2 мг / мл соответственно. 3 мкл мкл раствора PLpro помещали в 384-луночные планшеты с использованием системы FluidX XRD, оснащенной 16-канальными картриджами для трубок. Планшеты центрифугировали в течение 1 минуты при 1000 x g, накрывали алюминиевой герметизирующей фольгой для предотвращения испарения и инкубировали при комнатной температуре в течение 30 минут.Реакцию начинали добавлением 3 мкл мкл тримера убиквитина K48 на весь аналитический планшет и инкубировали при комнатной температуре в течение 30 минут. Реакцию останавливали добавлением 3 мкМ мкл TFA – конечная концентрация 2% (об. / Об.) С добавлением 4 мкМ 15 N меченного убиквитина. TTP Labtech Mosquito® HTS, оборудованный 5-позиционной платформой для планшетов, использовали для смешивания образца и матрицы DHAP и для нанесения смеси на мишень MALDI. Четыре 384-луночных планшета объединяли в один планшет-мишень Anchor Chip 1536 BC MALDI-TOF.Пятнистые и высушенные мишени MALDI подвергали автоматическому MALDI-TOF MS-анализу. Масс-спектры получали с помощью прибора RapifleX MALDI-TOF / TOF от Bruker Daltonics, оснащенного программным обеспечением Compass для FlexSeries 2.0. Масс-спектры получали в диапазоне масс m / z 8000–9200, чтобы включить сигналы убиквитина (8565,76 кДа) и 15 N убиквитина (8669,47 кДа). Было накоплено 4000 лазерных выстрелов на пятно образца в режиме положительной ионизации с использованием импульсной экстракции ионов 500 нс с частотой лазера 10 кГц, настройкой дигитайзера 5.00 Гвыб / с, и один параметр Smartbeam в диапазоне сканирования 800 µ м. Полученные спектры обрабатывались с детектированием пика центроида, установленным на отношение сигнал / шум (S / N), равным 5, и сглаживанием по Гауссу (0,5 m / z; 10 циклов). Сигнал 15 N убиквитина был добавлен в список контроля массы и использован в качестве внутреннего калибранта. Данные MALDI-TOF, обработанные с помощью flexAnalysis, были экспортированы в виде файла с разделителями-запятыми (.csv). Далее наборы данных обрабатывались с помощью Excel или GraphPad Prism (v7.03; Программное обеспечение GraphPad, Ла-Хойя, Калифорния). Активность PLpro отслеживали с использованием измеренной площади (сигнала) ферментативного продукта (убиквитина) и соответствующего меченого внутреннего стандарта ( 15 N убиквитина). Все точки данных были представлены как отношение сигнала убиквитина к сигналу внутреннего стандарта. Сгенерированные данные образца были выражены как процент от контроля (PoC) в соответствии со следующим уравнением: Были ли b средним значением для отрицательных контролей, а c – средним значением для положительных контролей.

Для оценки надежности и качества кампании по обнаружению попаданий был использован ключевой показатель, параметр Z ’(Zhang et al , 1999), как для следующего уравнения: Были ли σ p, , σ n , как стандартные отклонения положительного и отрицательного контроля, и µ p , µ n , как разность средних значений положительного и отрицательного контролей. GraphPad Prism использовался для графического представления данных.

Набор соединений, одобренных FDA: Apex bio DiscoveryProbe ™ одобренная FDA библиотека лекарств (Кат.L1021) представляет собой уникальную коллекцию малых молекул, одобренных FDA в 1971 году, с известными данными о биодоступности и безопасности для людей.

Защитные продукты – промышленные поставки

Выберите категорию Продукты безопасности COVID19 Дренажные трубки Пробирки для проверки газа Обнаружение асбеста – Обнаружение свинца , SCBA Строительная продукция Баррикада, сетка Электроинструменты Такелажные кабели Арматурные колпачки Мешки для оборудования электробезопасности Краски для маркировки, защитные ленты Контроль разливов, Сорбенты, Легковоспламеняющиеся хранилища, Бидоны для прекращения пожара, Воронки Контейнеры для прекращения огня Мешки для обезвоживания, дренажные ограждения, входные ограждения, защитные отстойники , Баллоны для хранения разливов Ящики для хранения Принадлежности для барабанов Шкафы для хранения легковоспламеняющихся веществ Сорбенты Контроль и хранение разливов, Поддоны для контроля разливов, Центр накопления в барабанах rs, Накопительные рампы для барабанаЭргономичная опора Опора для спины Локоть, опора для запястья и кисти Защита для ног, Защита для пальцев ног Опора для колена – опора для лодыжки Защита глаз и лица Защитные очки и защитные очки Экономичные защитные очки MCR Safety Tomahawk Series RADIANS Rad-Sequel Series Стандартные защитные очки Jackson Safety HellRaiser Серия Jackson Safety Nemesis Series MCR Safety Klondike Metal Series MCR Safety Storm Series Pyramex Avante Series Pyramex Cortez Series Pyramex Exeter Series Pyramex Mini Ztek Series Pyramex Venture II Series Pyramex Zone II Pyramex Ztek Series RADIANS DeWalt Series RADIANS DeWalt DC Dual Comfort RADIANS DeWalt DC Dual Comfort Radius Вентилятор RADIANS Rad-Infinity Series RADIANS Revelation Series RADI ANS Strike Force II SPERIAN A800 Series SPERIAN A900 Series SPERIAN UVEX Ignite Series Premium Safety Glasses JACKSON Safety Magnum 3G Series MCR Safety PRO Rubicon Series MCR Safety PRO Tremors Series SPERIAN UVEX Genesis Series OTG Защитные очки Считыватели Защитные очки Считыватели Pyramex V2 Pyramex Ztek Readers Безопасность при сварке Очки Защитные очки Аксессуары для очков Боковые щитки Очки Чехлы, чехлы и фиксаторы Очки для чистки линз Защитные очки Защитные очки Защитные очки Сварочные защитные очки и защитные очки Продукты для обслуживания оборудования, Фрезы для удержания и хранения ТОиР и электрические инструменты Противопожарные фонари и защитное освещение Товары для уборки, Промышленные товары Безопасность завода, Безопасность парковок, безопасность дорожного движения Оборудование для защиты от падения DBI Sala Fall Protection Equipmen t ОБОРУДОВАНИЕ ДЛЯ ЗАЩИТЫ ОТ ПАДЕНИЙ MILLER Средства защиты от падения MSA Защита от падения PROTECTA от DBI Sala Защита от падения Ремни для защиты тела Защитные ограждения СИЗ Мешки СИЗ Оборудование для защиты от падения Комплекты для защиты от падения Ремни Ремни безопасности Системы защиты от падения Системы выдвижных ремней Противопожарная безопасность Противопожарные одеяла Огнетушители Пожарная безопасность Дым Детекторы Хранение горючих материаловПродукция первой помощи Продукты биобезопасности 3-слойные маски для лица Тестирование на наркотики Детекторы алкоголя Чашки для теста на наркотики Тесты на наркотики для пероральной жидкости Тесты на наркотики Экстренное реагирование Экстренные одеяла СЛР, дефибрилляторы Спасательные крючки Носилки Травматологические комплекты Для мытья глаз Шланги для экстренной помощи, душ для душа Капли для глаз Раствор для мытья глаз Первичная аварийная промывка глаз Вторичные станции экстренной промывки глаз Товары первой помощи Липкие ленты первой помощи В первую очередь Аэрозольные баллончики для оказания первой помощи. Первая помощь. Пакеты – Горячие пакеты Первая помощь Стерильные ватные палочки – Стерильные ватные палочки – Депрессоры для языка – Ватные шарики Первая помощь Эластичные бинты Первая помощь Перцовый спрей Первая помощь Форецепс Первая помощь Пинцет Первая помощь Марлевые салфетки – Марлевые компрессы Марлевые салфетки для первой помощи Первая помощь Ингалянты Инструменты первой помощи MDI CPR Microshields Первая помощь Мази Первая помощь Пластиковые бинты Аппликаторы для первой помощи Шины для первой помощи Плетеные бинты Защита кожи Симптомы для снятия лекарств Таблетки с лекарствами Антациды, облегчение пищеварения Холод Облегчение, облегчение гриппа, облегчение синуса Обезболивание, снятие воспаления Фонари – Защитное освещениеБезопасное напольное покрытие Обнаружение газа Обнаружение газа GASTEC Обнаружение газа SPERIAN Biosystems Обнаружение газа Технологии BW By Honeywell Обнаружение газа Обнаружение газа Honeywell MSA Калибровочные газовые баллоны Газоанализаторы Регуляторы Газоанализаторы Датчики Защита рук Химически стойкие перчатки , Латексные перчатки, Перчатки с покрытием из ПВХ, Перчатки с покрытием из нитрила, Перчатки с покрытием из ПВХ, устойчивые к порезам перчатки и рукава, Кевларовые перчатки Одноразовые перчатки, Одноразовые латексные перчатки, Одноразовые нитриловые перчатки, Напудренные перчатки, Неопудренные перчатки, Детские кроватки Рабочие перчатки общего назначения, Хлопок Рабочие перчатки, перчатки из джерси, парусиновые рабочие перчатки Термостойкие перчатки Аксессуары для рабочих перчаток, Одноразовые настенные органайзеры для перчаток Рабочие перчатки из кожи Специальные рабочие перчатки из ПВА, перчатки из EVOH, ламинированные рабочие перчатки Рабочие перчатки, перчатки для механиков Защита головы Аксессуары для защиты головы sories Защитные колпачки Каски Специальные каски Защита слуха, беруши Защитные ленты для слуха Проводные беруши Беруши без проводов Диспенсеры и заправки для беруш Наушники Сохранение слуха Теплозащитные банданы – Повязки для пота – Охлаждающие жилеты Охладители IGLOO, одноразовые диспенсеры для рабочей одежды IGLOOR Бумажные стаканчики, чашки IGLOOR , Одежда Hi-Viz, Защитные жилеты Аксессуары для спецодежды High-Vis Метлы Емкости для сигарет Промышленные чистящие средства Промышленные тряпки, промышленные полотенца, промышленные салфетки Блокировка / маркировка продуктов Блокировка / маркировка соответствия Блокировка / маркировка устройств Блокировка / маркировочные комплекты Блокировка / маркировка станций Блокировка / маркировка тегов Замки для блокировки / маркировки Морские буи Защитные устройства связи Спасательные жилеты Защитные заграждения для морских судов Защитная рабочая одежда – огнестойкая одежда – рабочая одежда Рабочая одежда для дуговой сварки Химически стойкая одежда Одноразовая рабочая одежда – одноразовые комбинезоны Рабочая одежда повышенной видимости Промышленные фартуки Лабораторные халаты Защитная рабочая одежда Рукава Сварочная одежда Зимняя рабочая одежда Рабочие комбинезоны Рабочие комбинезоны Рабочие куртки Рабочие брюки Рабочие рубашки Raingear Ponchos Дождевики – Куртки от дождя Комбинезоны от дождя Дождевики Средства защиты органов дыхания Средства защиты органов дыхания 3M Средства защиты органов дыхания ALLEGRO Средства защиты органов дыхания GERSON Средства защиты органов дыхания MOLDEX Средства защиты органов дыхания MSA Средства защиты органов дыхания NORTH Средства защиты органов дыхания SPERIAN Средства защиты органов дыхания Willson Тестирование полнолицевых респираторов Респираторы-полумаски PAPR , Поставляемые воздушные респираторы Аксессуары для защиты органов дыхания Картриджи для респираторов, фильтры для респираторов Защитные очки Защитные очки эконом-класса Защитные очки серии 3M OX Защитные очки 3M Virtua серии AP Защитные очки 3M Virtua Sport Защитные очки 3M Virtua серии V4 Защитные очки серии 3M Virtua V6 Защитные очки Cordova Boxer Series Cordova Bulldog Серия Cordova Citation Series Cordova Doberman Series Cordova Retriever II Series Cordova Slammer Series Crews Защитные очки Klondike Crews Law 2 Защитные очки RADIANS Защитные очки Rad-Sequel серии Radnor Защитные очки SPERIAN серии A400 Стандартные защитные очки Защитные очки серии 3M BX Защитные очки серии 3M Lexa 3M Защитные очки серии Nuvo Защитные очки серии 3M Privo Защитные очки серии 3M Virtua Sport CCS Защитные очки для экипажей Swagger Защитные очки JACKSON Safety Hel Серия lraiser JACKSON Safety Nemesis Series MCR Safety Desperado Series MCR Safety Storm Series Pyramex Avante Series Pyramex Solara Series Pyramex Venture II Series RADIANS DeWalt Series SPERIAN A700 Series SPERIAN A800 Series SPERIAN A900 Series SPERIAN UVEX Bandit защитные очки SPERIAN Falcon Защитные очки SPERIAN UVEX Байонетные очки Очки Защитные очки SPERIAN UVEX Защитные очки Mercury Защитные очки SPERIAN UVEX Защитные очки Женские очки Защитные очки SPERIAN серии W100 Sperian серии W200 Защитные очки премиум-класса Защитные очки серии 3M Maxim Защитные очки 3M Metaliks Спортивные защитные очки 3M Moon Dawg Очки Защитные очки 3M Smart Lens Экипажи Защитные очки ForceFlex Экипажи Hellion Safety Очки Crews Защитные очки Rattler Crews Защитные очки Triwear JACKSON Safety Magnum серии 3G Безопасность MCR Серия PRO Rubicon MCR Безопасность Серия PRO Tremor SPERIAN UVEX Защитные очки Adaptec SPERIAN UVEX Защитные очки Astrospec SPERIAN UVEX Flashback Защитные очки SPERIAN UVEX Предохранительные металлические очки SPERIAN UVEX Genesis Series SPERIAN UVEX Milennia Защитные очки SPERIAN UVEX Защитные очки Skyper SPERIAN UVEX Сейсмостойкие очки SPERIAN UVEX Сейсмостойкие очки SPERIAN UVEX Сейсмостойкие очки Защитные очки UVEX SolarPro Защитные очки SPERIAN UVEX Tomcat Защитные очки SPERIAN UVEX Защитные очки для паров OTG Защитные очки для считывателей Защитные очки 3M BX Dual Readers Защитные очки 3M Lexa Readers Защитные очки 3M Nuvo Series Защитные очки Экипажи Лупа Klondike Защитные очки Pyramex V2 Считыватели Pyramex Ztek Series Read SPERIAN A Readers Лупа Защитные очки Защитные очки Аксессуары для очков Боковые щитки для очков Футляры, чехлы и фиксаторы для очков Очищение линз для очков Безопасность при сварке Очки Защитная обувь Защитная обувь Аксессуары Резиновые сапоги, резиновые бахилыЗнаки безопасности Знаки допуска Двуязычные знаки Знаки биологической опасности Знаки безопасности Знаки химикатов Знаки безопасности в замкнутом пространстве Знаки строительства Электрические знаки Знаки окружающей среды Знаки выхода Знаки пожарной безопасности Знаки первой помощи Знаки инвалидности Знаки домашнего хозяйства Знаки блокировки / маркировки Знаки отсутствия курения Рабочие знаки Знаки парковки Знаки СИЗ Знаки радиации Знаки туалета Баннеры безопасности Идентификация безопасности Знаки стимулирования безопасности Этикетки безопасности Табло безопасности Табло безопасности Знаки безопасности Знаки Стенды Знаки безопасности дорожного движения Знаки маркировки транспортных средств Знаки складских знаков Светоотражающая лента безопасности Безопасность дорожного движения Защитные накладки ADA Защитные барьеры, системы барьеров для дорожного движения Безопасность дорожного движения Конусы, Посты-указатели безопасности дорожного движения Маркировка безопасности дорожного движения и ветроуказатели Одежда с высокой видимостью Знаки безопасности дорожного строительства, Стойки для знаков безопасности дорожного строительства Продукция для безопасности дорожного движения, Средства безопасности на стоянках Безопасность грузовиков, Безопасность транспортных средств Продукция Сварочные перчатки Сварочные маски Сварочная защитная спецодежда

Newsroom – BioscienceLA ​​

26 июля 2021 года USC сообщило, что в некоторых статьях о Маршалле есть выпускница.Некоторые подчеркивают успех в бизнесе, выходящий за рамки повседневного. Некоторые истории фокусируются на реальном влиянии и улучшении жизни.

Кэтрин Купер и Консорциум технологий и инноваций в педиатрии Западного побережья (CTIP), недавно ставшие объектами тематического исследования Пай-Линь Инь и Бенджамина Ростокера для Центра исследований предпринимательства Ллойда Грейфа, представляют все три. Дело «Кэтрин Купер и CTIP: повышение разнообразия в медицинских технологиях» было сосредоточено на пути увеличения разнообразия среди соискателей портфеля CTIP и заняло третье место в конкурсе Case for Women 2020, организованном Emerald Publishing.

Образовательный путь Купер привел ее из лаборатории лаборатории Калифорнийского университета в Гарвард-Уэстлейк, Стэнфорд, где она была принята в медицинскую школу им. Кека.

После нескольких лет учебы в Keck она переключилась на бизнес-мир стартапов в сфере здравоохранения; сначала в компании, занимающейся технологиями здравоохранения, затем в компании FIGS Medical Apparel по просьбе друга из Стэнфорда. Руководя развитием бизнеса, Купер поступил на программу MBA Marshall Online. Кульминация ее опыта в медицине и бизнесе, в том числе связей, установленных в USC, побудила ее проконсультироваться и в конечном итоге взять на себя роль содиректора с CTIP.

История Купера заключает в себе все, что угодно, кроме линейного пути, который многие видят для успеха в медицине или бизнесе, не говоря уже о их комбинации.

«Я никогда не ожидал, что стану участником тематического исследования», – сказал Купер. «Это обычно то, что обычно ассоциируется с руководителями компаний из списка Fortune 500, и может быть сложно думать о себе таким образом».

Развитие этой способности видеть себя в центре внимания кейса – и актуальность для студентов, которые, возможно, никогда не считали себя главными героями кейса, – было основной мотивацией для Купера.

Репрезентация – это возможность обучения

«Некоторые ученики видят, что их опыт и идентичность представлены все время в классе, и им никогда не приходится выходить за пределы себя, чтобы быть в центре истории», – сказал Купер. «Другие никогда не видят в представлении своего опыта или кого-либо, подобного им, и постоянно прилагают эти познавательные усилия, чтобы заняться делами, уроками в классе».

Ее пригласили выступить в двух классах по недавно опубликованному тематическому исследованию; бакалавриат и один на уровне MBA.

По ее словам, наибольшее влияние на нее оказали отзывы, которые она получила после занятий. Вопросы студентов, по сути, позволили ей «увидеть» дело и его влияние их глазами.

«Когда я говорила с классом бакалавриата, женщины, которые обычно не участвовали в обсуждениях в классе, были очень вовлечены в вопросы», – сказала она. «А на занятии MBA потом подошла женщина, чтобы рассказать, как это было вдохновляюще – узнать о чернокожих женщинах на руководящих должностях. У нас состоялась прекрасная беседа о возможностях инвестирования и инноваций.«

Участие студентов в этом деле означало, что оно прошло успешно, – сказала она.

«Цель взаимодействия с процессом рассмотрения дела – помочь другим понять и изучить инновации в сфере здравоохранения», – сказала она.

Обсуждая потенциальное дело с Инь, Купер также участвовала в качестве выпускницы в целевой группе DEI Центра Грейфа. Она обнаружила, что эти два опыта дополняют друг друга.

«Это был невероятный опыт, – сказал Купер, – давая возможность из первых рук увидеть, что делает Центр Грайфа для изменения преподавания предпринимательства.”

Добавляемая стоимость

Помимо того, что цветная женщина видит в ней предпринимательского игрока, дело CTIP помогает студентам понять роль, которую организация играет на рынках ускорителей и медицинского оборудования.

До прихода Купера в 2017 году CTIP, финансируемый Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA), в основном распределял гранты на инновации. Купер помог вести трансформацию и реорганизацию, поэтому он больше работал как акселератор и фонд микро-венчурных капиталовложений, хотя и использовал то же государственное финансирование.

«Подход Кэтрин гарантировал, что компании, которые она поддерживает в области педиатрических медицинских устройств, получили не только некоторое финансирование», – сказал Дэн Вадхвани, профессор клинического предпринимательства в Центре Грайфа, который преподавал этот случай, «но также и руководство и доступ к сеть для управления сложным процессом утверждения и коммерциализации ».

Вадхвани использовал пример CTIP в качестве «модели» для студенческих проектов. Группам студентов было поручено определить возможности в отрасли, в которой они могли бы оказать целевое влияние, а затем им были предоставлены гипотетические 5 миллионов долларов на разработку портфолио и разумной программы ускорения.

«Это оказался фантастический способ для студентов стратегически узнать об инновациях», – сказал Вадхвани.

«Все это было безумно, – сказал Купер. «Лучшим из возможных способов».

% PDF-1.4 % 181 0 объект > эндобдж 136 0 объект > поток DOI: 10.1073 / pnas.1414748111application / pdf10.1073 / pnas.1414748111 http://dx.doi.org/10.1073/pnas.14147481112014-09-06false10.1073/pnas.1414748111

  • www.pnas.org
  • www.pnas.org
  • 10.1073 / pnas.14147481112014-09-06false
  • www.pnas.org
  • 2021-08-01T22: 03: 45-07: 002021-08-01T22: 03: 45-07: 002014-09-06T15: 26: 45 + 05: 30Arbortext Advanced Print Publisher 9.1.510 / W UnicodeAcrobat Distiller 10.1.8 (Windows) uuid: 20261bc2-1dd2-11b2-0a00-aa0927bd7700uuid: 20261bc6-1dd2-11b2-0a00-

    0000000 конечный поток эндобдж 67 0 объект > эндобдж 32 0 объект > эндобдж 98 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / Properties> / XObject >>> / Rotate 0 / Thumb 76 0 R / Type / Page >> эндобдж 262 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / Thumb 49 0 R / Type / Page >> эндобдж 127 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / Thumb 144 0 R / Type / Page >> эндобдж 287 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / Thumb 156 0 R / Type / Page >> эндобдж 159 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / Thumb 288 0 R / Type / Page >> эндобдж 4 0 obj > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / Thumb 162 0 R / Type / Page >> эндобдж 185 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / Thumb 133 0 R / Type / Page >> эндобдж 36 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / Thumb 137 0 R / Type / Page >> эндобдж 211 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / Thumb 51 0 R / Type / Page >> эндобдж 72 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / Thumb 85 0 R / Type / Page >> эндобдж 338 0 объект > поток HWv8} WQc1 ~ 鴥 t: ϙCSE * \ h ~ j) Yt

    , Каталог конфигурационных факторов радиационной теплопередачи

    , Обобщенный алгоритм с разделенным окном для получения температуры поверхности земли из космоса – Журналы и журнал IEEE

    , Алгоритм разделения температуры и излучения для усовершенствованных изображений космического радиометра теплового излучения и отражения (ASTER) – Журналы и журнал IEEE

    Л.Аделард, Моделирование температуры неба и приложения в моделировании зданий, Возобновляемая энергия 15, стр. 418-430, 1998.
    URL: https://hal.archives-ouvertes.fr/hal-00766267

    Ф. Айрес, Дистанционное зондирование с помощью прибора инфракрасного зондирования атмосферы интерферометра 2. Одновременное получение атмосферных профилей температуры, водяного пара и озона, Журнал геофизических исследований, том 107, 2002.

    Ф. Айрес, Новый подход к нейронной сети, включающий первые предположения для извлечения водяного пара в атмосфере, пути жидкой воды в облаках, температуры поверхности и коэффициентов излучения над сушей по данным спутниковых микроволновых наблюдений, Journal of Geophysical Research: Atmospheres, vol.106, pp.2156-2202, 2001.

    и. Солвер, Труды Международной конференции по теории и приложениям компьютерной графики, стр.225-232, 2010.

    А. Аппель, Некоторые методы рендеринга твердых тел с помощью машины затенения, Протокол конференции AFIPS, 1968.

    Д. Аркес и С. Мишлен, Proximity Radiosity: Использование когерентности для ускорения вычислений с форм-фактором, en, in: Rendering Techniques ’96, pp. 143-152, 1996.

    Дж. Н. Эш и Дж. Меола, Разделение температурно-излучательной способности для LWIR-зондирования с использованием MCMC, Алгоритмы и технологии для мультиспектральных, гиперспектральных и ультраспектральных изображений XXII, вып.9840, 2016.

    , ASSIMP – Open-Asset-Importer-Lib

    , Коды переноса атмосферного излучения, en, in: Wikipedia, p.881103099, 2019.

    Д. Балагеас, Введение в структурный мониторинг здоровья, Структурный мониторинг здоровья, стр. 13-43, 2010 г.

    А. М. Болдридж, Спектральная библиотека АСТЕР, версия 2.0 », en, Дистанционное зондирование окружающей среды, том 113, стр. 344257, 2009.

    А. Бардуччи и И. Пеппи, Получение температуры и коэффициента излучения из изображений, полученных с помощью дистанционного зондирования, с использованием метода «излучения серого тела», IEEE Transactions on Geoscience and Remote Sensing, vol.34, стр 681-695, 1996.

    Ф. Беккер и З. Ли, Температура поверхности и коэффициент излучения в различных масштабах: определение, измерение и связанные проблемы, Обзоры дистанционного зондирования, том 12, стр. 275-7257, 1995.

    Ф. Беккер и З. Ли, Независимые от температуры спектральные индексы в тепловых инфракрасных диапазонах, Дистанционное зондирование окружающей среды, том 32, стр. 34-4257, 1990.

    Ф. Беккер и З. Ли, К методу локального разделенного окна над земной поверхностью, Международный журнал дистанционного зондирования, вып.11, выпуск 3, стр 1366-5901, 1990.

    А. Берк, Л. С. Бернштейн и Д. К. Робертсон, MODTRAN: модель среднего разрешения для LOWTRAN, en, tech. представитель, SPECTRAL SCIENCES INC BURLINGTON MA, 1987.

    К. Берретт, Байесовская непараметрическая модель температурно-излучательной способности длинноволновых гиперспектральных изображений, Технометрика, том 56, стр. 40-1706, 2014.

    Ф. Крейг, Д. Р. Борен и. Хаффман, Поглощение и рассеяние света малыми частицами, 1998.

    Д.Брюне, Э. Р. Врскей и З. Ван, О математических свойствах индекса структурного подобия, том 21, стр. 1057-7149, 2012.

    Дж. Дж. Буглиа, Введение в теорию переноса излучения в атмосфере, Исследования в области геофизической оптики и дистанционного зондирования, 1985.

    Э. Сересо, Исследование методов рендеринга мультимедиа, Визуальный компьютер, том 21, стр. 1432-2315, 2005 г.
    URL: https://hal.archives-ouvertes.fr/inria-00510151

    С. Чандрасекар и Р.Передача, 1960.

    Ю. М. Чанг, Исследование факторов, влияющих на инфракрасные измерения температуры в зданиях, SPIE 780. Термосенс ​​IX, стр. 11-18, 1987.

    К. Ву, Сопоставление трехмерных моделей с помощью исправлений, не зависящих от точки обзора (VIP), Конференция IEEE 2008 г. по компьютерному зрению и распознаванию образов, стр. 1-8, 2008 г.

    К. Ву, Поиск 3D-моделей и оценка позы на основе отдельных изображений с использованием VIP-функций, Конференция компьютерного общества IEEE по компьютерному зрению и семинарам по распознаванию образов, стр.1-8, 2008.

    X. Чен, Эффект смешанных пикселей в фенологии земной поверхности: исследование с помощью моделирования, Дистанционное зондирование окружающей среды, том 211, стр. 34-4257, 2018.

    Дж. Чинг, Дж. Л. Бек и К. А. Портер, Байесовское состояние и оценка параметров неопределенных динамических систем, Вероятностная инженерная механика, том 21, стр. 266-8920, 2006.

    А. Александр-Адриан-Шотар, Н. Оже и. Хансен, Кумулятивная адаптация размера шага для линейных функций, 2012.

    Х. Пер и.Кристенсен, Приблизительное растекание цвета по точкам, Фестиваль анимационных фильмов в Анси, стр.9, 2019.

    К. Хшановски, Сравнение коротковолновых и длинноволновых измерительных тепловизионных систем, Прикладная оптика, том 34, стр.2888-2897, 1995.

    К. Хшановски, Влияние условий измерения и параметров системы на точность дистанционного измерения температуры с помощью двухспектральных ИК-систем, Инфракрасная физика и технология, том 37, стр. 295-306, 1996.

    М. Кларк, Д. Макканн и М.Форде, Применение инфракрасной термографии для неразрушающего контроля бетонных и каменных мостов, NDT & E International, Structural Faults and Repair, vol.36, issue 4, pp.60-69, 2003.

    П. Б. Коутс, Многоволновая пирометрия, том 17, стр.103, 1981.

    М. Ф. Коэн, Эффективный подход радиосигнала для синтеза реалистичных изображений, Компьютерная графика и приложения IEEE, том 6, стр. 272-1716, 1986.

    Ф. Майкл, Д. П. Коэн и. Гринберг, Hemi-Cube: решение радиосвязи для сложных сред, ACM SIGGRAPH Computer Graphics, vol.19, стр 31-40, 1985.

    Ф. Майкл, Дж. Р. Коэн и. Уоллес, “Радиосити и реалистичный синтез изображений”, издательство AP Professional, 1995.

    М. Ф. Коэн, Подход прогрессивного уточнения к быстрой генерации изображений радиосигнала, компьютерная графика ACM SIGGRAPH, том 22, стр. 75-84, 1988.

    Г. Кумб, М. Дж. Харрис и А. Ластра, Радиосити на графическом оборудовании, ACM SIGGRAPH 2005 Courses on -SIGGRAPH ’05, p.179, 2005.

    Купер П. И. Поглощение излучения в солнечных штифтах, Солнечная энергия, т.12, выпуск 3, стр 333-346, 1969.

    , Хранилище данных Коперника

    C. Коробка-данные,

    Т. М. Ковер и Дж. А. Томас, Элементы теории информации, en, Серия Wiley в телекоммуникациях, 1991.

    К. Крассин, Интерактивное непрямое освещение с использованием отслеживания воксельного конуса, стр.10, 2011 г.
    URL: https://hal.archives-ouvertes.fr/hal-00650173

    А. К. Ноэль, К. К. Кресси, и. Викл, Статистика пространственно-временных данных, Ряд Уайли в вероятности и статистике, 2011.

    A. Crinière, Contribution au développement d’outils d’analyse de sequences d’images infrarouges: Application au contrôle non destructif de Structures de Génie Civil, 2014.

    A. Crinière, J. Dumoulin и L. Mevel, Управление локальными мультисенсорами, применяемыми для SHM и долгосрочного инфракрасного мониторинга: реализация Cloud2IR, Quantitative In-fraRed Thermography Journal 0.0 (октябрь 2018 г.), стр. 1768- 6733

    A. Crinière, Cloud2IR: Инфракрасная термография и датчики окружающей среды, интегрированные в автономную систему для долгосрочного мониторинга конструкций », en, in: European Geoscience Union EGU2016, 2016.

    . Бисва-натх-датта, Численные методы для линейных систем управления: проектирование и анализ, 2004.

    A. Vriendt, La Transmission de la chaleur: Introduction au rayonnement thermique, Français, vol.2

    С. Дин, Применение термографических изображений неразрушающего контроля аэрокосмических конструкций, инфракрасная физика и технологии, том 97, стр. 1350-4495, 2019.

    П. Делмораль, Моделирование среднего поля для интеграции Монте-Карло, Монографии по статистике и прикладной вероятности, 2013.
    URL: https://hal.archives-ouvertes.fr/hal-00932211

    F. Derkx, Concept de Plate-forme Mobile Instrumentée (PMI) pour l’inspection des ouvrages d’art, fr, p.6

    , Определение токсичности грунтовых субстратов после добычи бурого угля с использованием лабораторных тестов воспроизводства с Enchytraeus Crypticus (Oligochaeta) | SpringerLink

    , Разработка статистических моделей прогнозирования температуры для тестовой дороги

    К. Дрованди, Ensemble MCMC: Accelerating Pseudo-Marginal MCMC for State Space Models Using the Ensemble Kalman Filter, 2019.

    Л. Дюбрей, Ю. Куинсат и К. Лартиг, Calibration Sur Modèle CAO Pour La Mesure Par Vision In-situ, 2015.

    Дж. А. Даффи, В. А. Бекман, Солнечная инженерия тепловых процессов, Английский язык, 2013.

    Дж. Дюмулен и В. Баучер, Инфракрасная термографическая система для исследования транспортной инфраструктуры со встроенными локальными измерениями атмосферных параметров и автономной моделью для оценки ослабления излучения, Журнал прикладного дистанционного зондирования, том 8, стр. 84978-084978, 2014.
    URL: https://hal.archives-ouvertes.fr/hal-01055043

    Дж. Дюмулен, А. Криньер и Р. Эверти, Обнаружение и определение тепловых характеристик внутренней структуры настила моста Musmeci с помощью инфракрасного термографического мониторинга, Журнал геофизики и инженерии, том 10, выпуск 6, стр. .1742-2140, 2013.
    URL: https://hal.archives-ouvertes.fr/hal-01081320

    П. Дутре, К. Бала и П. Бекаерт, Advanced Global Illumination, en, pp.978-979, 2006.

    , Эффективное моделирование переноса света в сценах с участвующими средами с использованием фотонных карт

    г.Объяснение-то и. Сэмплер, Американский статистик, том 46

    С. Фокё, Инфракрасные изображения моря: анализ чувствительности и экспериментальная проверка с использованием измерений кампании MIRAMER в конфигурациях солнечного блеска, Прикладная оптика, том 52, стр. 1539-4522, 2013.

    А. Мартин, Р. К. Фишлер, и. Боллс, Консенсус случайной выборки: парадигма для подгонки модели с приложениями для анализа изображений и автоматизированной картографии, Readings in Computer Vision, pp.726-740, 1987.

    Дж.Гаскуэль, Быстрые нелинейные проекции с использованием графического оборудования, Труды симпозиума 2008 г. по интерактивной трехмерной графике и играм -SI3D ’08, стр.107, 2008 г.
    URL: https://hal.archives-ouvertes.fr/hal- 00257806

    Н. Гастинель, Линейный численный анализ, 1970.

    Г. Гауссорг и С. Шомет, Инфракрасная термография, en, 1993.

    У. Р. Гилкс и П. Уайлд, Адаптивная выборка отклонения для выборки Гиббса, Журнал Королевского статистического общества. Серия C (Прикладная статистика), т.41, pp.35-9254, 1992.

    . Ар-гиллеспи, Теоретический базовый документ алгоритма разделения температуры и излучения, версия 2.4, en, 1999.

    А. Р. Гиллеспи, Остаточные ошибки в стандартных продуктах ASTER по температуре и излучательной способности AST08 и AST05, том 115, стр. 34-4257, 2011.

    К. М., Моделирование взаимодействия света между диффузными поверхностями, Труды 11-й ежегодной конференции по компьютерной графике и интерактивным методам, SIGGRAPH ’84, стр 213-222, 1984.

    Н.Дж. Гордон, Д. Дж. Салмонд и А. Ф. Смит, Новый подход к нелинейному / негауссовскому байесовскому оцениванию состояния, IEE Proceedings F-Radar and Signal Processing, vol.140, pp.956-375, 1993.

    С. Гортлер, М. Ф. Коэн и П. Слусаллек, Методы радиосвязи и релаксации “, en, IEEE Computer Graphics and Applications, vol.14, issue 6, pp.272-1716, 1994.

    г. Cuda, -. Программирование, и. Франция,

    Г. Кумб и М. Харрис, Глобальное освещение с использованием радиосигнала прогрессивного уточнения, Драгоценные камни графических процессоров: методы программирования для высокопроизводительной графики и вычислений общего назначения, т.2, стр.0-321

    Э. Гринзато, В. Вавилов и Т. Кауппинен, Количественная инфракрасная термография в зданиях, энергетике и зданиях, том 29, выпуск 1, стр. 378-7788, 1998.

    D. Groleau, F. Fragnaud, J. Rosant, Моделирование радиационного поведения городского квартала Марселя с помощью модели SOLENE, Proceedings ICUC-5, p.4, 2003.

    К. Геймар, Простая модель для алгоритмов переноса солнечного света в атмосфере (SMARTS2) и оценка эффективности, en, 1995.

    Д. К. Гамильтон, У. Р. Морган, Коэффициенты конфигурации радиантного обмена, en, 1952.

    Н. Хансен, Стратегия развития CMA: сравнительный обзор, 2006 г.

    Р. И. Хартли и А. Зиссерман, Многоканальная геометрия в компьютерном зрении, Second, p.521540518, 2004.

    П. С. Хекберт, Текстуры с адаптивным излучением для двунаправленной трассировки лучей, Труды 17-й ежегодной конференции по компьютерной графике и интерактивным методам, SIGGRAPH ’90, стр.145-154, 1990.

    Х. В. Хендерсон и С. Р. Серл, О выводе обратной суммы матриц, SIAM Review, том 23, стр. 36-1445, 1981.

    А. Энон, Терморадиационное моделирование с высоким разрешением городского фрагмента в центре Марселя во время кампании UBL-ESCOMPTE, en, in: Building and Environment, vol.46, p.3601323, 2011.

    , Иерархическое излучение на искривленных поверхностях | SpringerLink, том 10

    Дж. Саймон и. Хук, Сравнение методов извлечения информации об излучательной способности из данных теплового инфракрасного излучения для геологических исследований, Дистанционное зондирование окружающей среды, т.42, pp.–, 1992.

    Х. К. Хоттель, Передача лучистого тепла между поверхностями, разделенными непоглощающей средой, Журнал теплопередачи, стр. 265-273, 1931.

    R. J. Howarth, Journel and (Ch. J.) Huijbregts. Горная геостатистика, Минералогический журнал, том 43, стр.1471-8022, 1979.

    Дж. Р. Хауэлл, Р. Сигел, М. П. Пинар, Тепловой перенос тепла. 5-е, 2010.

    , IASLonline NetArt: История компьютерного искусства IV.2 Компьютерная анимация

    , Интегрированная система мониторинга состояния конструкций и интеллектуального управления вантовым мостом

    H.Джонс и Х. Сро, Масштабирование тепловых изображений с различным пространственным разрешением: проблема смешанных пикселей, стр. 2073-4395, 2014.

    Н. Кантас, О методах частиц для оценки параметров в моделях пространства состояний, Статистическая наука, том 30, стр. 883-4237, 2015.

    С. Кавасима, Связь между температурой поверхности и температурой воздуха в локальном масштабе в течение зимних ночей, Журнал прикладной метеорологии, том 39, стр. 1570-1579, 2000.

    А. Келлер, Instant Radiosity, Труды 24-й ежегодной конференции по компьютерной графике и интерактивным методам -SIGGRAPH ’97, стр.49-56, 1997.

    А. Мансур, К. Хан, Т. В. Аллеманд, и. Игар, Бесконтактное измерение температуры. I. Методы, основанные на интерполяции, Обзор научных инструментов, том 62, стр. 34-6748, 1991.

    М. Конник и Дж. Уэлш, Высокоуровневое численное моделирование шума в фотодатчиках CCD и CMOS: обзор и учебное пособие, 2014.

    Дж. Крапез, Радиационные измерения температуры, тепловые измерения и обратные методы, теплопередача, OCLC: ocn587104377, 2011.

    Н.Лаланн, Разработка и проверка численного инструмента для моделирования поля температуры поверхности и визуализации инфракрасного излучения в городской среде, en, in: Quantitative InfraRed Thermography Journal, vol.12, pp.2116-7176, 2015.
    URL: https : //hal.archives-ouvertes.fr/hal-01111310

    Б. Лейн, Неопределенность измерений температуры с помощью инфракрасной термографии для резки металлов, Metrologia 50.6 (декабрь 2013 г.), стр. 1681-7575

    Б. Ласкоуп, О возможности обнаружения дефектов в композиционных материалах на основе периодического термического возбуждения, Композиты, Часть B: Техника, стр.1023-1030, 2013.
    URL: https://hal.archives-ouvertes.fr/hal-00845958

    Дж. Лоран, Прямое сокращение света: масштабируемый подход к глобальному освещению в реальном времени, en, vol.35, p.1677055, 2016.
    URL: https://hal.archives-ouvertes.fr/hal-01444811

    Л. Микаэль и. Bohec, Contribution Du Rayonnement Au Confort Thermique et Aux Économies d’énergie Dans l’habitat, 2017.

    К. Винсент-ле, Приложения Des Réseaux de Capteurs Intelligent et de La Communication sans Fil à l’instrumentation Des Structures de Genie Civil, Bulletin des Laboratoires des Ponts et Chaussées 273, стр.9-37, 2008.

    NL Touz, T. Toullier и J. Dumoulin, Инфракрасная термография, применяемая для исследования нагретых и солнечных покрытий: от численного моделирования до небольших лабораторных экспериментов, Thermosense: Thermal Infrared Applications XXXIX, vol.10214, p.1021413, 2017 .
    URL: https://hal.archives-ouvertes.fr/hal-01563851

    С. Лефевр, С. Хорнус и Ф. Нейрет, Текстуры октодерева на графическом процессоре, Самоцветы графического процессора: методы программирования для высокопроизводительной графики и вычислений общего назначения, вып.2, pp.0-321
    URL: https://hal.archives-ouvertes.fr/inria-00402118

    Дж. Лехтинен, Безсеточное иерархическое представление для легкого транспорта, Транзакции ACM на графике, том 27, стр.7300301, 2008 г.
    URL: https://hal.archives-ouvertes.fr/inria-00345275

    Дж. Лехтинен, Безсеточные конечные элементы для иерархического глобального освещения, en, Publications in Telecommunications Software and Multimedia, p.12

    F. L’entretien-du-réseau-Routier-en,

    Ф.Чжао-лян-ли и. Беккер, Возможность определения температуры поверхности земли и коэффициента излучения по данным AVHRR, Дистанционное зондирование окружающей среды, том 43, стр. , 1993.

    З. Ли, Ф. Петитколин и Р. Чжан, Физически обоснованный алгоритм для определения коэффициента излучения земной поверхности на основе комбинированных данных в среднем и тепловом инфракрасном диапазоне, Science in China Series E: Technological Sciences, vol.43, pp.1862- 281, 2000.

    З. Ли, Оценка шести методов извлечения спектров относительной излучательной способности из тепловых инфракрасных изображений, Дистанционное зондирование окружающей среды, т.69, pp.197-214, 1999.

    З. Ли, Температура поверхности суши, полученная со спутников: текущее состояние и перспективы, Дистанционное зондирование окружающей среды 131, стр. 14–37, 2013.

    З. Ли, Л. Чжао и З. Фу, Оценка суммарного радиационного потока на Тибетском плато путем ассимиляции продуктов MODIS LST с ансамблевым фильтром Калмана и фильтром частиц, в: Международный журнал прикладных наблюдений за Землей и геоинформации, том 19 , стр 303-2434, 2012.

    С. Цзюнь, Р. Лю, и. Чен, Последовательные методы Монте-Карло для динамических систем, Журнал Американской статистической ассоциации, т.93, стр. 162-1459, 1998.

    Г. Мачин и. Чу, Высококачественные источники черного тела для инфракрасной термометрии и термографии между -40 и 1000 ° C, The Imaging Science Journal, том 48, стр 1743-131, 2000.

    Г. Масиелло, Физическое определение коэффициента излучения поверхности и температуры фильтра Калмана по геостационарному инфракрасному излучению, en, vol.6, pp.1867-8548, 2013.

    А. Мбиок и Р. Вебер, Излучение в ограждениях: проблема эллиптических граничных значений, en, Scientific Computing, 2000.

    Л. М. Макмиллин, Оценка температуры поверхности моря по двум измерениям через инфракрасное окно с различным поглощением, en, vol.80, pp.2156-2202, 1975.

    Р. Мехри, Применение генетических фильтров для уменьшения температуры поверхности земли, en, vol.119, p.2169897, 2014.

    С. К. Мердинк, Спектральная библиотека ECOSTRESS, версия 1.0, Дистанционное зондирование окружающей среды, том 230, стр. 34-4257, 2019.

    М. Меттке, Nuklear: ANSI C Gui Library с одним заголовком, 2018.

    В. Минкина, С. Дудзик, Имитационный анализ неопределенности пути измерения и обработки инфракрасной камерой, том 39, стр. 263-2241, 2006.

    Минкина В., Дудзик С. Инфракрасная термография: ошибки и неопределенности, 2009.

    М. Ф. Модест, Радиационная теплопередача, en, третье издание, OCLC: ocn813855549, 2013.

    J. Monchau, Mesure d’émissivité pour la thermographie infrarouge appliquée au диагностический количественный анализ структур, 2013.

    .Парри-хирам-мун, Научные основы светотехники, en, 1936.

    W. Nusselt, Graphische bestimmung des winkelverhaltnisses bei der wärmestrahlung, vol.20, p.673, 1928.

    Т. Омар и М. Л. Нехди, Дистанционное зондирование бетонных настилов мостов с использованием инфракрасной термографии беспилотных летательных аппаратов, Автоматизация в строительстве, том 83, стр. 360-371, 2017.

    , OpenGL – отраслевой стандарт высокопроизводительной графики

    R. B. Helcio и. Орланд, Тепловые измерения и обратные методы, теплопередача, OCLC: ocn587104377, 2011.

    М. Паулин и Дж. Джессел, Адаптивная генерация сетки для прогрессивного излучения: алгоритм на основе трассировки лучей, en, vol.13, pp. 1467-8659, 1994.
    URL: https: //hal.archives-ouvertes. fr / hal-01516279

    , Температура поверхности земли, полученная с помощью усовершенствованного радиометра с очень высоким разрешением и путевого сканирующего радиометра 1

    . Разрешение_радиометра_и_длинно-трековый_радиометр_1_теория,

    , Зональный метод расчета интенсивности света в присутствии участвующей среды

    E.Pebesma, Набор данных Meuse: Краткое руководство по пакету Gstat R, en, 2019.

    М. Пеллегрини, Аппроксимация форм-факторов Монте-Карло с априорной ошибкой, дискретная и вычислительная геометрия, том 17, стр. 1432-0444, 1997.

    М. Пфендер, Э. Люпферт и П. Хеллер, Пирометрические измерения температуры на солнечных тепловых высокотемпературных приемниках, Журнал инженерии солнечной энергии, том 128, выпуск 3, стр.1996231, 2006.

    , Физический рендеринг: от теории к реализации

    Дж.Х. Пьерлуисси, К. Э. Марагудакис и Р. Тегераномовахед, Новая модель низкотрановых полос для водяного пара, Прикладная оптика, том 28, стр. 1539-4522, 1989.

    Планк М. Теория теплового излучения, Энтропия 144, т. 190, стр. 164, 1900.

    В. Ци, Ф. Ли и Л. Чжэньчжун, Китайская конференция по контролю и принятию решений, стр. 3354-3358, 2010 г.

    , Получение параметров атмосферы и поверхности суши из спутниковых тепловых инфракрасных гиперспектральных данных с использованием метода нейронной сети, Международный журнал дистанционного зондирования, т.34, вып.9

    А. Рогальский, История инфракрасных детекторов, en, vol.20, pp.1896-3757, 2012.

    О. Рустан и Ю. Девиль, Re) Dice Packages for Computer Experiments, Troisièmes rencontres R, 2014.

    О. Рустант, Д. Гинсбургер и Ю. Девиль, Два пакета для анализа компьютерных экспериментов с помощью метамоделирования и оптимизации на основе кригинга, Журнал статистического программного обеспечения, том 51, 2012.
    URL: https: // hal. archives-ouvertes.fr/hal-00495766

    Д.Э. Сабол, Проверка в полевых условиях алгоритма разделения температурной излучательной способности ASTER, Дистанционное зондирование окружающей среды, том 113, стр. 34-4257, 2009.

    Ф. Сакума и С. Хаттори, Установление практического стандарта температуры с помощью узкополосного радиационного термометра с кремниевым детектором, Кейри Кэнкджо Хкоку, стр.91-97, 1983.

    П. Д. Сэмпсон, Подгонка конических сечений к «очень разрозненным» данным: итеративное уточнение алгоритма Букштейна, Компьютерная графика и обработка изображений, т.18, pp.97-108, 1982.

    П. Сондерс, Общие интерполяционные уравнения для калибровки радиационных термометров, том 34, стр. 26-1394, 1997.

    Б. Сеговия, Дж. К. Иел и Б. Перош, Metropolis Instant Radiosity, Форум компьютерной графики, том 26, выпуск 3, стр. 1467-8659, 2007 г.
    URL: https: //hal.archives-ouvertes. fr / hal-01501494

    А. Б. Шапиро, Компьютерная реализация, точность и синхронизация алгоритмов коэффициента обзора излучения, Journal of Heat Transfer, vol.107, стр 22-1481, 1985.

    М. С. Шепард, Подходы к автоматическому созданию и управлению сетками из конечных элементов, Обзоры прикладной механики, том 41, выпуск 4, стр. 3-6900, 1988.

    П. Ширли, Hybrid Radiosity / Monte Carlo Methods, en, p.24

    П. Ширли, Сложность времени радиосвязи Монте-Карло, компьютеры и графика, том 16, выпуск 1, стр.117-120, 1992.

    Д. Шрейнер, Руководство по программированию OpenGL: Официальное руководство по изучению OpenGL, 2013.

    р.Шамуэй и Д. Стоффер, Временные ряды: подход к анализу данных с использованием R, английский, стр.978-978, 2019.

    X. François and. Силлион, Унифицированный иерархический алгоритм глобального освещения с рассеивающими объемами и кластерами объектов, IEEE Transactions по визуализации и компьютерной графике, том 1, выпуск 3, 1995.

    X. François, C. Sillion, and. Пуэч, Общий двухпроходный метод интегрирования зеркального и диффузного отражения, Proceedings of SIGGRAPH ’89, pp.335-344, 1989.

    Х.Франсуа, К. Силлион и. Пуэч, Радиосити и глобальное освещение, том 11, 1994.

    X. François and. Силлион, Решение глобального освещения для общих распределений отражения, Материалы конференции SIGGRAPH’91, стр.187-196, 1991.

    , SMARTS: Простая модель переноса солнечного света в атмосфере | Модернизация сети | NREL

    W. C. Снайдер, Коэффициент излучения на основе классификации для измерения температуры поверхности Земли из космоса, Международный журнал дистанционного зондирования, вып.19, стр 1366-5901, 1998.

    Дж. А. Собрино, Улучшения в методе разделения окна для определения температуры поверхности земли, IEEE Transactions по геонауке и дистанционному зондированию, том 32, выпуск 2, стр.1962892, 1994.

    Дж. Собрино, Многоканальные и многоугловые алгоритмы оценки температуры поверхности моря и суши с помощью данных ATSR, Международный журнал дистанционного зондирования, том 17, стр. 2089-2114, 1996.

    Г. Сориа и Дж. А. Собрино, Температура поверхности земли, полученная ENVISAT / AATSR над неоднородной областью, Дистанционное зондирование окружающей среды, т.111, стр 34-4257, 2007.

    Э. М. Спарроу, Р. Д. Сесс, Радиационная теплопередача, en, 1978.

    , Оценка пространственно-временного поля с использованием фильтра Кригеда Калмана (KKF) с размещением датчика, обеспечивающим разреженность

    Дж. У. Спенсер, Представление положения Солнца рядами Фурье, стр.172, 1971.

    М. Л. Стейн, Интерполяция пространственных данных: некоторая теория кригинга, en, Springer Series in Statistics, pp.978-978, 1999.

    И. Э. Сазерленд, Трехмерный ввод данных с помощью планшета, Труды IEEE, vol.62, стр 18-9219, 1974.

    , Flir Systems, Полное руководство по инфракрасным технологиям для профессионалов в области исследований и разработок

    Р. Теннисон, Структурный мониторинг состояния инновационных мостов в Канаде с помощью оптоволоконных датчиков, интеллектуальных материалов и конструкций 10, стр. 560, 2001.

    , Применение искусственных нейронных сетей для анализа данных дистанционного зондирования: Международный журнал дистанционного зондирования, том 29

    , официальный веб-сайт YAML

    Т. Тулье, Ж. Дюмулен, В.Буржуа, Сравнительное исследование предварительного обнаружения горячих ящиков движущихся поездов и подсчета осей путем внедрения двух инфракрасных камер на месте, Конференция по количественной инфракрасной термографии QIRT Asia 2019, 2019.
    URL: https://hal.archives-ouvertes.fr / hal-02264672

    Н. Л. Туз, Концепция и инфраструктура транспорта с позитивной энергией: термомеханическая модификация с оптимизацией энергетических систем, 2018.

    М. П. Утриллас, Сравнительное исследование параметризованных моделей SPCTRAL2 и SMARTS2 на основе измерений спектральной освещенности в Валенсии, Испания, Solar Energy, vol.63, стр 161-171, 1998.

    Х. К. Ван-де-Хюльст, Рассеяние света малыми частицами, 1957.

    С. Ван-де и. Виджвер, Влияние параметров окружающей среды на термографический анализ ограждающих конструкций здания, 12-я Международная конференция по количественной инфракрасной термографии, 2014 г.

    К. Ведель и К. Пуэх, Стенд для тестирования адаптивного подразделения в прогрессивной радиосити, Второй семинар Еврографики по рендерингу, 1991.

    С. Венафра, ПОЛУЧЕНИЕ ТЕМПЕРАТУРЫ ПОВЕРХНОСТИ И ИЗЛУЧЕНИЯ ИЗ ДАННЫХ СЕВИРИ: ВНЕДРЕНИЕ МЕТОДОЛОГИИ ФИЛЬТРА KALMAN ДЛЯ ПОЛНОГО ДИСКА И ПРОВЕРКА С НАБЛЮДЕНИЯМИ НА МЕСТЕ, 2015.

    Дж. Р. Уоллес, М. Ф. Коэн и Д. П. Гринберг, Двухпроходное решение уравнения визуализации: синтез методов трассировки лучей и излучения, Труды 14-го

    , Ежегодная конференция по компьютерной графике и интерактивным методам, SIGGRAPH ’87, стр. 311-320, 1987.

    Г. Валлнер, Решатель радиосити с расширенным графическим процессором: включая диффузное и зеркальное отражение и передачу, Визуальный компьютер, том 25, стр. 1432-2315, 2009.

    Б. Уолтер, Lightcut: масштабируемый подход к освещению, ACM SIGGRAPH 2005, стр.10, 2005.

    Х. Ван, Изготовление матрицы микроболометров на интегральной схеме непланарного считывания, Международный журнал инфракрасных и миллиметровых волн, том 26, стр. 1572-9559, 2005.

    Т. Уиттед, Улучшенная модель освещения для затемненного дисплея, Commun. ACM, том 23, выпуск 6, стр 343-349, 1980.

    O. Wiki, Обзор конвейера рендеринга – OpenGL Wiki, 2019.

    К. Кристофер, Н. Викл, и. Кресси, Подход с уменьшением размерности к пространственно-временной фильтрации Калмана, 1999.

    Дж. Йон, 320 x 240 неохлаждаемый IRFPA с вакуумной упаковкой для тонкой пленки Pixel Wise, Международное общество оптики и фотоники, том 8541, стр. 85410, 2012.

    М. Згал, Л. Мевел и П. Д. Мораль, Оценка модальных параметров с использованием взаимодействующего фильтра Калмана, Механические системы и обработка сигналов, том 47, стр. 139-150, 2014 г.
    URL: https: //hal.archives- ouvertes.fr/hal-00824108

    ?. T. Toullier, J. Dumoulin и L. Mevel, Количественный анализ систематической ошибки измерений из-за экологической и пространственной дискретизации при долгосрочном тепловом мониторинге конструкций с использованием наружной инфракрасной термографии, Quantitative Infrared Thermography (QRT) Journal, 2019.

    Т. Тулье, Ж. Дюмулен,;. Тулье, Ж. Дюмулен и Л. Мевел, Сравнительное исследование предварительного обнаружения горячих ящиков движущихся поездов и подсчета осей с помощью двух инфракрасных камер на месте, Publication dans des conférences internationales avec acte et comité de lecture?, Стр. -27, 2019.
    URL: https://hal.archives-ouvertes.fr/hal-02264672

    ?. T. Toullier, J. Dumoulin и L. Mevel, Изучение систематической ошибки измерений из-за окружающей среды и пространственной дискретизации при долгосрочном тепловом мониторинге конструкций с помощью инфракрасной термографии, с.14
    URL: https://hal.archives-ouvertes.fr/hal-018

    , Конференция по количественной инфракрасной термографии, 2018.

    ?. T. Toullier, J. Dumoulin и L. Mevel, Сравнение измерений поверхности термопарами и инфракрасной термографии для теплового мониторинга транспортной инфраструктуры, 14-й международный семинар по передовым инфракрасным технологиям и приложениям, AITA 2017, 2017.
    URL: https: // hal .archives-ouvertes.fr / hal-02139133

    ?. Н. Ле-Тоуз, Т.Тулье и Ж. Дюмулен, Применение инфракрасной термографии для исследования нагретых и солнечных покрытий: от численного моделирования до небольших лабораторных экспериментов, Conférence Thermosense XXXIX, 2017.
    URL: https://hal.archives-ouvertes.fr/hal -01563851

    , Communications dans des conférences internationales avec acte

    ?. T. Toullier, J. Dumoulin и L. Mevel, Чувствительность различных методов для одновременной оценки излучательной способности и температуры посредством моделирования многоспектральной инфракрасной термографии, Инновационные приборы, методы, геофизические методы и модели для приповерхностной геофизики, городов и транспортных инфраструктур, 2019 .
    URL: https://hal.archives-ouvertes.fr/hal-02264677

    ?. T. Toullier, J. Dumoulin и L. Mevel, Инновационные приборы, методы, геофизические методы и модели для приповерхностной геофизики, городов и транспортных инфраструктур, 2018.

    Т. Тулье, Ж. Дюмулен и Л. Мевель, Исследование и развитие моделирования в трехмерных изображениях и динамических наблюдениях за инфракрасной термографией, стр. 27

    ?. Т. Тулье, Ж. Дюмулен, Л.Mevel, Étude de sensibilité de différentes méthodes de séparation for lévaluation simultanée de lémissivité et de la température par thermography multisppectrale, 26ème Conférence de la Société Française de Thermique, 2018.

    ?. T. Toullier, J. Dumoulin и L. Mevel, Этюд по сравнительному анализу двух подходов, интегрированные термопары и инфракрасная термография, для наблюдения за термической инфраструктурой дюн на транспорте, 2017.

    ,? Doctoriales du Département Cosys de l’IFSTTAR, présentation des travaux réalisés à ce jour, стр.